tdbR00001034

NameValue
Coding AA: Gln
Anticodon sequence: $UG
Organism: Vibrio cholerae C6706 NCBI:txid948564
RNA type: cytoplasmic
Sequence: AGGUCUA4CGCCAAGCGGUAAGGCAACGGGUU$UGAUCCCGUCAŁCCCAUGGUUCGAAUCCAUGUAGACCUGCCA
Unmodified sequence: AGGUCUAUCGCCAAGCGGUAAGGCAACGGGUUUUGAUCCCGUCAUCCCAUGGUUCGAAUCCAUGUAGACCUGCCA
Secondary structure: (((((((..(((.........))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: User
Version: unversioned, created: Oct. 29, 2020, modified: July 2, 2025
Folding free energy [kcal/mol]: -23.50
Pre-aligned sequence:
Pre-aligned secondary structure:
-AGGUCUA4CGCCAAGC--GGU--AAGGCAACGGGUU$UGAUCCCGUCA-------------------ŁCCCAUGGUUCGAAUCCAUGUAGACCUGCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • MODOMICS: a database of RNA modification pathways. 2017 update.
    Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki
    Nucleic acids research
    volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030
Comments: Ł is acetylated acp3U (acacp3U). At the moment when record is added there is no abbreviation for this modification in MODOMICS database

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer
We are using technical cookies that are necessary for page to work correctly.