tdbR00001047 (deprecated)

NameValue
Coding AA: Leu
Anticodon sequence: UAG
Organism: Vibrio cholerae C6706 NCBI:txid948564
RNA type: cytoplasmic
Sequence: GCGGAAG4GGCGAAAUUGGUAGACGCACCAGAUUUAGKUUCUGGCGCCGCAAGGUGUAAGAGUUCAAGUCUCUUCUUCCGCACCA
Unmodified sequence: GCGGAAGUGGCGAAAUUGGUAGACGCACCAGAUUUAGGUUCUGGCGCCGCAAGGUGUAAGAGUUCAAGUCUCUUCUUCCGCACCA
Secondary structure: (((((((..(((...........))).(((((.......)))))............(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model (last update Oct. 29, 2020)
Prepared by: User
Version: unversioned, created: Oct. 29, 2020, modified: Nov. 8, 2024
Folding free energy [kcal/mol]: 100000.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCGGAAG4GGCGAAAUU-GGUA-GACGCACCAGAUUUAGKUUCUGGCGCC------GCAA-----GGUGUAAGAGUUCAAGUCUCUUCUUCCGCACCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • MODOMICS: a database of RNA modification pathways. 2017 update.
    Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki
    Nucleic acids research
    volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030
Next entry: tdbR00001047 (July 2, 2025, 2:55 p.m.)

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
We are using technical cookies that are necessary for page to work correctly.