tdbR00000491

Name	Value
Coding AA:	Trp
Anticodon sequence:	BCA
Organism:	Phaseolus vulgaris NCBI:txid3885
RNA type:	cytoplasmic
Sequence:	GCGCUCUUAGUUCAGUUC#GDAGAACRCGGGPCUBCAHAACCCGAU7.CGUAGGTPCAAAUCCUACAGAGCGUGCCA
Unmodified sequence:	GCGCUCUUAGUUCAGUUCGGUAGAACGCGGGUCUCCAAAACCCGAUGACGUAGGUUCAAAUCCUACAGAGCGUGCCA
Secondary structure:	(((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	2 (Oct. 4, 2024), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-24.20
Pre-aligned sequence: Pre-aligned secondary structure:	-GCGCUCUUAGUUCAGUUC#GD--AGAACRCGGGPCUBCAHAACCCGAU-------------------7.CGUAGGTPCAAAUCCUACAGAGCGUGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Sequence and codon recognition of bean mitochondria and chloroplast tRNAsTrp: evidence for a high degree of homology. L Maréchal, P Guillemaut, J M Grienenberger, G Jeannin, J H Weil Nucleic acids research volume: 13 issue: 12 date: June 25, 1985 PUBMED ID: 3847869
Comments:	47 . IS A MODIFIED NUCLEOTIDE; 37 + OR *
Previous entry:	tdbR00000491 (Oct. 4, 2024, 2:53 p.m.)

Model based on:

RNA Composer