tdbR00000333

Name	Value
Coding AA:	Gln
Anticodon sequence:	$UG
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	UGGGGUA4CGCCAAGC#GDAAGGCACCGGUJU$UG/PACCGGCAUUCCCUGGTPCGAAUCCAGGUACCCCAGCCA
Unmodified sequence:	UGGGGUAUCGCCAAGCGGUAAGGCACCGGUUUUUGAUACCGGCAUUCCCUGGUUCGAAUCCAGGUACCCCAGCCA
Secondary structure:	(((((((..(((.........))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-28.10
Pre-aligned sequence: Pre-aligned secondary structure:	-UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGUJUNUG/PACCGGCA-------------------UUCCCUGGTPCGAAUCCAGGUACCCCAGCCA .(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	The nucleotide sequences of the two glutamine transfer ribonucleic acids from Escherichia coli. M Yaniv, W R Folk The Journal of biological chemistry volume: 250 issue: 9 date: May 10, 1975 PUBMED ID: 164464 The output of the tRNA modification pathways controlled by the Escherichia coli MnmEG and MnmC enzymes depends on the growth conditions and the tRNA species. Ismaïl Moukadiri, M-José Garzón, Glenn R Björk, M-Eugenia Armengod Nucleic acids research volume: 42 issue: 4 epub: Nov. 30, 2013 PUBMED ID: 24293650 DOI: 10.1093/nar/gkt1228

Model based on:

RNA Composer