tdbR00000119

Name	Value
Coding AA:	Gly
Anticodon sequence:	{CC
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	GCGGGCAUCGUAUAAUGGCUAUUACCUCAGCCU{CCAAGCUGAUGAUGCGGGTPCGAUUCCCGCUGCCCGCUCCA
Unmodified sequence:	GCGGGCAUCGUAUAAUGGCUAUUACCUCAGCCUUCCAAGCUGAUGAUGCGGGUUCGAUUCCCGCUGCCCGCUCCA
Secondary structure:	(((((((..(((..........))).(((((.......)))))....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-27.50
Pre-aligned sequence: Pre-aligned secondary structure:	-GCGGGCAUCGUAUAAU--GGCU-AUUACCUCAGCCUNCCAAGCUGAUG-------------------A-UGCGGGTPCGAUUCCCGCUGCCCGCUCCA .(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	The output of the tRNA modification pathways controlled by the Escherichia coli MnmEG and MnmC enzymes depends on the growth conditions and the tRNA species. Ismaïl Moukadiri, M-José Garzón, Glenn R Björk, M-Eugenia Armengod Nucleic acids research volume: 42 issue: 4 epub: Nov. 30, 2013 PUBMED ID: 24293650 DOI: 10.1093/nar/gkt1228 Nucleotide sequence studies of normal and genetically altered glycine transfer ribonucleic acids from Escherichia coli. J W Roberts, J Carbon The Journal of biological chemistry volume: 250 issue: 14 date: July 25, 1975 PUBMED ID: 167016
Comments:	34 N IS A MODIFIED U

Secondary structure

Tertiary structure

Model based on:

Moderna

RNA Composer

We are using technical cookies that are necessary for page to work correctly.