tdbR00000498

NameValue
Coding AA: Trp
Anticodon sequence: BCA
Organism: Gallus gallus NCBI:txid9031
RNA type: cytoplasmic
Sequence: GACCUCGUKLCGCAAC#GDAGCGCRPCUGABUBCAKAZCAGAAG7CUGCGUGPPCG"AUCACGUCGGGGUCACCA
Unmodified sequence: GACCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGCUGCGUGUUCGAAUCACGUCGGGGUCACCA
Secondary structure: (((((((..((((.......)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -25.10
Pre-aligned sequence:
Pre-aligned secondary structure:
-GACCUCGUKLCGCAAC--#GD--AGCGCRPCUGABUBCAKAZCAGAAG-------------------7CUGCGUGPPCG"AUCACGUCGGGGUCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • A primer ribonucleic acid for initiation of in vitro Rous sarcarcoma virus deoxyribonucleic acid synthesis.
    F Harada, R C Sawyer, J E Dahlberg
    The Journal of biological chemistry
    volume: 250 issue: 9 date: May 10, 1975 PUBMED ID: 164470
  • Purification of tryptophan transfer RNA from chick cells and its identity with "spot 1" RNA of Rous sarcoma virus.
    L C Waters, W K Yang, B C Mullin, J L Nichols
    The Journal of biological chemistry
    volume: 250 issue: 16 date: Aug. 25, 1975 PUBMED ID: 169254

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer
We are using technical cookies that are necessary for page to work correctly.