tdbR00000351

NameValue
Coding AA: Arg
Anticodon sequence: NCG
Organism: Haloferax volcanii NCBI:txid2246
RNA type: cytoplasmic
Sequence: GGGCGCUUAGCUCA(UCUGGACAGAGULCUUGGCUNCGKACCAAGUUGC?ACGGG]PBOAAUCCUGUAGCGCCCACCA
Unmodified sequence: GGGCGCUUAGCUCAGUCUGGACAGAGUGCUUGGCUUCGGACCAAGUUGCCACGGGUUCAAAUCCUGUAGCGCCCACCA
Secondary structure: (((((((..((((..........))))((((((.......))))))....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -26.80
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGGCGCUUAGCUCA(UCUGGAC-AGAGULCUUGGCUNCGKACCAAGUU-------------------GC?ACGGG]PBOAAUCCUGUAGCGCCCACCA
.(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:
  • Structure of the archaeal transfer RNA nucleoside G*-15 (2-amino-4,7-dihydro- 4-oxo-7-beta-D-ribofuranosyl-1H-pyrrolo[2,3-d]pyrimidine-5-carboximi dam ide (archaeosine)).
    J M Gregson, P F Crain, C G Edmonds, R Gupta, T Hashizume, D W Phillipson, J A McCloskey
    The Journal of biological chemistry
    volume: 268 issue: 14 date: May 15, 1993 PUBMED ID: 7683667
  • Halobacterium volcanii tRNAs. Identification of 41 tRNAs covering all amino acids, and the sequences of 33 class I tRNAs.
    R Gupta
    The Journal of biological chemistry
    volume: 259 issue: 15 date: Aug. 10, 1984 PUBMED ID: 6746655
Comments: 26 PARTIALLY G

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer
We are using technical cookies that are necessary for page to work correctly.