tdbR00000386

NameValue
Coding AA: Ser
Anticodon sequence: UGA
Organism: Mycoplasma mycoides NCBI:txid2102
RNA type: cytoplasmic
Sequence: GGAAGAUUACCCAAGUCCGGCDGA"GGGAUCGGUCUUGA=AACCGAGAGUCGGGGAAACCCGAGCGGGGGUUCGAAUCCCUCAUCUUCCGCCA
Unmodified sequence: GGAAGAUUACCCAAGUCCGGCUGAAGGGAUCGGUCUUGAAAACCGAGAGUCGGGGAAACCCGAGCGGGGGUUCGAAUCCCUCAUCUUCCGCCA
Secondary structure: (((((((..(((.............))).(((((.......)))))...................(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -22.80
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGAAGAUUACCCAAGUCCGGCDGAHGGGAUCGGUCUUGA=AACCGAGAGUCGGG-GAAA--CCCGAG--CGGGGGUUCGAAUCCCUCAUCUUCCGCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • MODOMICS: a database of RNA modification pathways. 2017 update.
    Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki
    Nucleic acids research
    volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030
  • Apparent lack of discrimination in the reading of certain codons in Mycoplasma mycoides.
    T Samuelsson, Y S Guindy, F Lustig, T Borén, U Lagerkvist
    Proceedings of the National Academy of Sciences of the United States of America
    volume: 84 issue: 10 PUBMED ID: 3554232

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer
We are using technical cookies that are necessary for page to work correctly.