tdbR00000179

NameValue
Coding AA: Lys
Anticodon sequence: $UU
Organism: Bacillus subtilis NCBI:txid1423
RNA type: cytoplasmic
Sequence: GAGCCAUUAGCUCAGUDGGDAGAGCAUCUGACU$UUÿAPCAGAGG7UCGAAGGTPCGAGUCCUUCAUGGCUCACCA
Unmodified sequence: GAGCCAUUAGCUCAGUUGGUAGAGCAUCUGACUUUUAAUCAGAGGGUCGAAGGUUCGAGUCCUUCAUGGCUCACCA
Secondary structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -25.10
Pre-aligned sequence:
Pre-aligned secondary structure:
-GAGCCAUUAGCUCAGUD-GGD--AGAGCAUCUGACU$UUHAPCAGAGG-------------------7UCGAAGGTPCGAGUCCUUCAUGGCUCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Lysine tRNAs from Bacillus subtilis 168: structural analysis.
    B S Vold, D E Keith, M Buck, J A McCloskey, H Pang
    Nucleic acids research
    volume: 10 issue: 10 date: May 25, 1982 PUBMED ID: 6808464
  • Identification of 2-methylthio cyclic N6-threonylcarbamoyladenosine (ms2ct6A) as a novel RNA modification at position 37 of tRNAs.
    Byeong-Il Kang, Kenjyo Miyauchi, Michal Matuszewski, Gabriel Silveira D'Almeida, Mary Anne T Rubio, Juan D Alfonzo, Kazuki Inoue, Yuriko Sakaguchi, Takeo Suzuki, Elzbieta Sochacka, Tsutomu Suzuki
    Nucleic acids research
    volume: 45 issue: 4 date: Feb. 28, 2017 PUBMED ID: 27913733 DOI: 10.1093/nar/gkw1120
Comments: 37 CAN BE 6 OR [

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer
We are using technical cookies that are necessary for page to work correctly.