tdbR00000035

NameValue
Coding AA: Asp
Anticodon sequence: GUC
Organism: Saccharomyces cerevisiae NCBI:txid4932
RNA type: cytoplasmic
Sequence: UCCGUGAUAGUUPAADGGDCAGAAUGGGCGCPUGUCKCGUGCCAGAU?GGGGTPCAAUUCCCCGUCGCGGAGCCA
Unmodified sequence: UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAGCCA
Secondary structure: (((((((..((((........)))).(((((.......)))))....(((((.......))))))))))))....
PDB ID: 2tra, 1il2
Homology model or
structure extracted from PDB:
Extracted Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]: -23.70
Pre-aligned sequence:
Pre-aligned secondary structure:
-UCCGUGAUAGUUPAAD--GGDC-AGAAUGGGCGCPUGUCKCGUGCCAG-------------------A-U?GGGGTPCAAUUCCCCGUCGCGGAGCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • The primary structure of aspartate transfer ribonucleic acid from brewer's yeast. II. Partial digestions with pancreatic ribonuclease and T 1 ribonuclease and derivation of complete sequence.
    J Gangloff, G Keith, J P Ebel, G Dirheimer
    Biochimica et biophysica acta
    volume: 259 issue: 2 date: Jan. 31, 1972 PUBMED ID: 4551153
  • Restrained refinement of two crystalline forms of yeast aspartic acid and phenylalanine transfer RNA crystals.
    E Westhof, P Dumas, D Moras
    Acta crystallographica. Section A, Foundations of crystallography
    volume: 44 ( Pt 2) date: March 1, 1988 PUBMED ID: 3272146
  • The structure of an AspRS-tRNA(Asp) complex reveals a tRNA-dependent control mechanism.
    L Moulinier, S Eiler, G Eriani, J Gangloff, J C Thierry, K Gabriel, W H McClain, D Moras
    The EMBO journal
    volume: 20 issue: 18 date: Sept. 17, 2001 PUBMED ID: 11566892

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer
We are using technical cookies that are necessary for page to work correctly.