tdbR00000183 (deprecated)

NameValue
Coding AA: Lys
Anticodon sequence: $UU
Organism: Saccharomyces cerevisiae NCBI:txid4932
RNA type: mitochondrial
Sequence: GAGAAUAUUGUUUAADGGDAAAACAGPUGPCU$UU6AGCAACCCAUGCUUGGTPCAACUCCAGCUAUUCUCACCA
Unmodified sequence: GAGAAUAUUGUUUAAUGGUAAAACAGUUGUCUUUUAAGCAACCCAUGCUUGGUUCAACUCCAGCUAUUCUCACCA
Secondary structure: (((((((..((((.......)))).(((((.......)))))....((.((.......)).)))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Nov. 8, 2024
Folding free energy [kcal/mol]: 100000.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-GAGAAUAUUGUUUAAD--GGD--AAAACAGPUGPCUNUU6AGCAACCC-------------------A-UGC_GGTPCAACUCCAGCUAUUCUCACCA
.(((((((..((((...........)))).(((((.......)))))........................((.((.......)).)))))))))....
Publications:
  • MODOMICS: a database of RNA modification pathways. 2017 update.
    Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki
    Nucleic acids research
    volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030
  • Codon reading patterns in Saccharomyces cerevisiae mitochondria based on sequences of mitochondrial tRNAs.
    A P Sibler, G Dirheimer, R P Martin
    FEBS letters
    volume: 194 issue: 1 date: Jan. 1, 1986 PUBMED ID: 2416594
Next entry: tdbR00000183 (July 2, 2025, 2:55 p.m.)

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
We are using technical cookies that are necessary for page to work correctly.