tdbR00000630 (deprecated)

NameValue
Coding AA: Ala
Anticodon sequence: HGC
Organism: Homo sapiens NCBI:txid9606
RNA type: cytoplasmic
Sequence: GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUHGCHUGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCCACCA
Unmodified sequence: GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCCACCA
Secondary structure: ((((((..((((........))))..(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: May 30, 2019, modified: Nov. 8, 2024
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGGGAAUUAGCUCAAAU-GGU--AGAGCGCUCGCUUHGCHUGCGAGAG-------------------GUAGCGGGAUCGAUGCCCGCAUUCUCCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP.
    Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl
    Cell reports
    volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: 10.1016/j.celrep.2017.07.029
Comments: Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAAla in HEK293 cells: 4.8%
Next entry: tdbR00000630 (July 2, 2025, 2:55 p.m.)

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
We are using technical cookies that are necessary for page to work correctly.