tdbR00000692

Name	Value
Coding AA:	Ile
Anticodon sequence:	IAU
Organism:	Homo sapiens NCBI:txid9606
RNA type:	cytoplasmic
Sequence:	GGCCGGUUAGCUCAGUCGGCUAGAGC;UGGUGCUIAUAACGCCAAGGUCGCGGGUUCGANCCCCGUAC;GGCCACCA
Unmodified sequence:	GGCCGGUUAGCUCAGUCGGCUAGAGCGUGGUGCUAAUAACGCCAAGGUCGCGGGUUCGAUCCCCGUACGGGCCACCA
Secondary structure:	((((.((..((((.........)))).(((((.......))))).....(((((.......))))))).))))....
Homology model or structure extracted from PDB:	Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: May 30, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-25.50
Pre-aligned sequence: Pre-aligned secondary structure:	-GGCCGGUUAGCUCAGUC-GGCU-AGAGC;UGGUGCUIAUAACGCCAAG-------------------GUCGCGGGUUCGANCCCCGUAC;GGCCACCA .((((.((..((((...........)))).(((((.......)))))........................(((((.......))))))).))))....
Publications:	Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP. Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl Cell reports volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: 10.1016/j.celrep.2017.07.029 Inosine modifications in human tRNAs are incorporated at the precursor tRNA level. Adrian Gabriel Torres, David Piñeyro, Marta Rodríguez-Escribà, Noelia Camacho, Oscar Reina, Adélaïde Saint-Léger, Liudmila Filonava, Eduard Batlle, Lluís Ribas de Pouplana Nucleic acids research volume: 43 issue: 10 date: May 26, 2015 epub: April 27, 2015 PUBMED ID: 25916855 DOI: 10.1093/nar/gkv277
Comments:	Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAIle in HEK293 cells: 24.6%

Secondary structure

Tertiary structure

Model based on:

Moderna

RNA Composer

We are using technical cookies that are necessary for page to work correctly.