| Summary | Using CHARGE-seq to survey the pools of charged tRNAs in amino-acid-deprived cells and investigate how amino acid deficit-associated patterns of tRNA charging affect protein synthesis. |
| Key findings | Activation of GCN2 and the translation of polyglutamine-encoding transcripts serve as key sensors of glutamine availability in mammalian cells |
| Sequencing strategy | RNA-Seq |
| Raw data | https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE157276 |
| Experimental protocol | Cells were treated as indicated, placed on ice, rinsed once with cold PBS and lysed with cold TRIzol (15596018, Life Technologies) on ice. Lysates were shaken with chloroform 5:1, centrifuged at 18,600 g and precipitated with 2.7x volumes of cold ethanol in presence of 30 μg of GlycoBlue Coprecipitant (AM9515, ThermoFisher) overnight. Samples were resuspended in 0.3M acetate buffer (pH = 4.5) with 10 mM EDTA and precipitated again. Next day, samples were resuspended in 10 mM acetate buffer with 1 mM EDTA. Of each RNA sample, 2 µg was treated with 10 mM of either sodium periodate (‘oxidized sample’) or sodium chloride (‘non-oxidized sample’) and incubated for 20 min at room temperature in the dark. Sodium periodate was from Sigma-Aldrich (311448). Reactions were quenched with glucose for 15 min. Yeast tRNAPhe (R4018, Sigma-Aldrich) was added to each sample, after which samples were precipitated with ethanol. Samples were resuspended in 50 mM Tris buffer (pH = 9) and incubated for 50 min at 37°C, quenched with acetate buffer and precipitated. Finally, samples were resuspended in RNAse-free water and subjected to a ligation to a 5′-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC /- 3′), using truncated KQ mutant T4 RNA ligase 2 (M0373, New England Biolabs), for 3 hr at room temperature, according to Loayza-Puch et al., 2016. Reverse transcription was performed with SuperScript IV reverse transcriptase (18090050, Thermo Scientific) according to the manufacturer’s instructions, with a primer complementary to the DNA adaptor. cDNA samples were subjected to qPCR with tRNA isodecoder-specific primers designed so that the forward (FW) primer was complementary to the 5′ end of the tRNA, and the reverse (RV) primer spanned the junction between the 3′ end of the tRNA and the ligated adaptor. The following primer pairs were used: ValMAC (FW: 5′-GTTTCCGTAGTGTAGTGGTTATCACGTTCG-3′, RV: 5′-GAGAATTCCATGGTGTTTCCGCCC-3′), iMetCAT (FW: 5′-AGCAGAGTGGCGCAGCG-3′. RV: 5′-GAGAATTCCATGGTAGCAGAGGATGGTTTCG-3′), eMetCAT (FW: 5′-GCCTCSTTAGCGCAGTAGGTAG-3′, RV: 5′-GAGAATTCCATGGTGCCCCSTS-3′) GlnCTG (FW: 5′-GGTTCCATGGTGTAATGGTNAGCACTCTG-3′, RV: 5′-GAGAATTCCATGGAGGTTCCACCGAGATTTG-3′), LeuWAG (FW: 5′-GGTAGYGTGGCCGAGCG-3′, RV: 5′-GAGAATTCCATGGCAGYGGTGGG-3′), ArgACG (FW: 5′-GGGCCAGTGGCGCAATG-3′, RV: 5′-GAGAATTCCATGGCGAGCCAGC-3′), yPhe (FW: 5′-GCGGAYTTAGCTCAGTTGGGAGAG-3′, RV: 5′-GAGAATTCCATGGTGCGAAYTCTGTGG-3′). After the reverse transcription step, 3′ end of cDNA was ligated to a 5′-phosphorylated DNA adaptor (5′-/5phos/AGATCGGAAGAGCGTCGTGTAGGGA/3ddC/- 3′) using T4 RNA ligase 1 (M0437, New England Biolabs) in presence of 20% PEG, 1 mM ATP and 30 mM hexammine cobalt(III) chloride (H7891, Sigma-Aldrich). Ligation products were subjected to eight cycles of PCR with primers containing 8-mer barcodes and p5 and p7 Illumina adaptors. PCR products were run out on an agarose gel and ~190 bp bands were excised, purified and subjected to MiSeq paired-end Illumina sequencing. |
| Analysis protocol | Unique mouse tRNA gene sequences were compiled from GtRNA database (http://gtrnadb.ucsc.edu/, RRID:SCR_006939) (Chan and Lowe, 2016). Sequences were appended with a 3′ CCA and used to create a reference assembly with the ‘bowtie2-build’ function. Paired-end 75 bp reads were trimmed of Illumina adapters and aligned to the reference assembly with ‘bowtie2’ run in ‘very-sensitive’ mode, allowing one mismatch to account for degeneracy that occurs at methylated adenine bases. Aligned reads were sorted and indexed with ‘samtools’ and a custom R script was used to assign gene alignments to each tRNA isodecoder. Reads were normalized by library size and the yeast phenylalanine tRNA spike-in counts prior to determining charge ratios. |
| Organism/cell line | Mus musculus (mouse embrionic fibroblasts) |
| Conditions | n Mouse embryonic fibroblasts were cultured for 6h with or without amino acids in the presence of glutaminase inhibitor (CB-839) or vehicle (DMSO). RNA was extracted from cells and treated with either 10mM sodium periodite ("oxidized") or sodium chloride ("non-oxidized) prior to sequencing library preparation to calculate tRNA charging ratios. |
| Approximate experimental time | 1-2 days |
| Starting RNA amount | 2 µg total RNA |
| tRNA expression | ++ |
| Base modifications | - |
| Charging status | + |
| tRNA processing and fragmentation | - |
| Citation | https://doi.org/10.7554/eLife.62307 |
2.0