| Full name | long hairpin oligonucleotide based tRNA high-throughput sequencing |
| Summary | CCA-specific 3ʹ-adapter is ligated to mature tRNAs without previous purification. The second adapter is ligated to the resulting cDNA 3ʹ-ends. As a result, both full-length and shorter cDNA fragments are included in the data analysis. Further, with the use of a selective adapter for mature tRNA 3ʹ-ends, no purification of a tRNA fraction is required, and a crude total RNA preparation can be used. |
| Key findings | Mature tRNAs carrying a 3′-CCA end can be selectively and efficiently captured from total RNA |
| Sequencing strategy | RNA-seq |
| Raw data | https://www.ncbi.nlm.nih.gov/bioproject/PRJNA541863 |
| Experimental protocol | Human embryonic kidney cells (HEK293T) were cultured under standard conditions. Cells were lysed with TRIzol® (Thermo Scientific) and used for total RNA isolation. Four leaves of Spinacia oleracea were disrupted in a CellCrusher® with liquid nitrogen and mixed with TRIzol®. Saccharomyces cerevisiae cells (BY4716) were grown as a liquid culture in YPAD medium overnight at 30°C. Cells were harvested by centrifugation, mixed with TRIzol® and disrupted in a FastPrep® cell homogenizer (MP Biomedicals) with 1 mm silica beads. Dictyostelium discoideum cells (gift of C. Hammann, Bremen) were taken up in TRIzol® (3 x 108 cells). Geobacillus stearothermophilus cells were cultivated in medium 220 at 50°C, harvested by centrifugation and treated with a FastPrep® cell homogenizer (MP-Biomedicals) and 1 mm silica beads. TRIzol® was added to the disrupted cells. Escherichia coli Top10 cells were cultured at 37°C in LB-medium, harvested by centrifugation and lysed with TRIzol®. For the preparation of tRNAs, 0.5 M NaCl and 5% (v/v) PEG8000 were added to the total RNA preparation. After incubation for 30 min at −20°C, the sample was centrifuged twice for 30 min at 4°C and 10.000 x g. Small RNAs in the supernatant were precipitated with 100% ethanol. The precipitated RNAs were redissolved and purified by polyacrylamide gel electrophoresis. A 100 pmol of the hairpin-shaped DNA adapter with 3ʹ-TGGN overhang (5ʹ-pCGACACTGTCGGTACCGACGGGAGAAGTCGGTACCGACAGTGTCGTGGNp-3‘) was incubated with 2–4 µg total RNA and 30 units T4 DNA ligase (NEB) in 66 mM Tris-HCl pH 7.6, 6.6 mM MgCl2, 10 mM DTT, 66 µM ATP and 25% (v/v) DMSO for 8 h at 32°C. The enzyme was heat-inactivated for 10 min at 65° and the ligation product was purified by ethanol precipitation For ligation with T4 RNA ligase 1, 50 pmol hairpin adapter and 10 pmol in vitro transcribed tRNAs with defined homogeneous 3ʹ-end were incubated 50 mM Tris/HCl pH 8.0, 10 mM MgCl2, 0.2 mg/ml BSA, 1 mM hexamine cobalt(III) chloride, 12.5% PEG, 1 mM ATP and 30 units RNA ligase 1 (NEB) for 16 h at 16°C. The reaction was stopped by incubation at 65°C for 15 min. For ligation with T4 RNA ligase 2, 10 pmol of the tRNA in vitro transcripts was incubated with 50 pmol hairpin adapter, 1 x T4 RNA ligase buffer (NEB) and 10 units RNA ligase 2 (NEB) for 1 h at 37°C following an incubation overnight at 4°C. tRNA ligated at the 3ʹ-end to the hairpin adapter was incubated with 100 pmol32P-labelled RT primer (5‘-CAAGC TCGGTACCGACAGTG-3‘; underlined sequence represents primer binding site for subsequent PCR) and 2 mM dNTPs for 5 min at 65°C and cooled down to room temperature. Reaction buffer (Thermo Scientific), 5 mM DTT, RNase inhibitor and 15 units SuperScript IV RT (Thermo Scientific) were added, and the reaction was incubated at 55°C for 30 min. The enzyme was heat-inactivated for 10 min at 80°C. cDNA was separated on a poly-acrylamide gel and visualized by autoradiography before purification by gel extraction. The gel-purified cDNA and 100 pmol of a DNA-only version of the Illumina TruSeq small RNA kit adapter (5‘-pGATCGTCGGACTGTAGAACTCTGAAC-AminoC6–3ʹ) were incubated in 50% (v/v) PEG8000, 1 x T4 RNA ligase buffer (NEB), 1 mM ATP, 1 mM cobalt hexamine chloride and 10 units T4 RNA ligase 1 (NEB) for 16 h at 16°C. The enzyme was heat-inactivated for 10 min at 65°C. cDNA carrying 5ʹ and 3ʹ adapter sequences was incubated in 1 x Phusion HF buffer, 0.2 µM dNTPs, 0.5 µM forward primer (5ʹ- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3ʹ; Illumina 5ʹ-PCR primer TruSeq small RNA library preparation kit), 0.5 µM index primer (5ʹ-CAAGCAGAAGACGGCATACGAGATNNNNNNTAGGACTCCATGCAAGCTCGGTACCGACAGTG-3ʹ; custom primer for Illumina TruSeq small RNA library preparation kit, NNNNNN – index) and 0.5 units Phusion HF DNA polymerase (Thermo Scientific) for 30 s at 98°C and amplified in 14 cycles (10 s at 98°C, 20 s at 60°C, 15 s at 72°C). A final elongation step for 2 min at 72°C completed the amplification. The PCR product was purified using the QiaQuick PCR purification kit (Qiagen) to remove unused PCR primers. 2–4 µg total RNA and 100 pmol 3ʹ-adapter (5ʹ-pUGGAATTCTCGGGTGCCAAGG-amino-C7-3ʹ) were incubated with 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 0.2 mg/ml BSA, 1 mM cobalt hexamine chloride, 12.5% (v/v) PEG8000, 30 µM ATP and 10 units T4 RNA ligase 1 (NEB) for 16 h at 25°C. The reaction was purified with the GeneJET RNA Cleanup and Concentration Micro Kit (Thermo Scientific, #K0841). Quality and concentration of the purified library constructs were determined on a 2100 Bioanalyzer (Agilent). High-throughput analysis of the libraries was done as single end run (150 nt) on a MiSeq System (Illumina®) with a custom primer designed for Illumina MiSeq analysis (5ʹ-CACTGTCGGTACCGAGCTTGCATGGAGTCCTA-3ʹ). |
| Analysis protocol | To separate the sequenced reads into individual FAstQ files, samples were demultiplexed using Illumina’s bcl2fastq Conversion Software (v2.20, https://support.illumina.com/downloads/bcl2fastq-conversion-software-v2-20.html), allowing 0 mismatches in the barcode sequences. Adapters of raw reads were trimmed using Cutadapt v1.16, retaining only reads which surpass a quality cutoff of 25, a maximum allowed error rate of 0.15 and a read length from 8 to 95 nts after trimming of adapter and low quality bases. For standard pre- and post-trimming quality control, FASTQC v0.11.4 was applied. Genomes of D. discoideum (dicty 2.7, assembly GCA_000004695), G. stearothermophilus (strain ATCC 12980, assembly GCA_001277805.1), E. coli (strain K-12 substr. MG1655, assembly GCA_000005845.2), S. oleracea (assembly GCA_002007265.1, KY768855.1), S. cerevisiae (strain BY4741, GCA_000766575.2) and H. sapiens (hg38, GCA_000001405.27) were downloaded from NCBI (Database resources of the National Center for Biotechnology Information 2016). Nuclear, pseudo and mitochondrial tRNAs were annotated with tRNAscan-SE v2.0 for each genome using the default parameter settings. For S. cerevisiae, only 16 of 24 mt-tRNAs could be annotated via tRNAscan-SE. The missing mt-tRNAs were added from the YeastMine database. The analysis was prepared on the basis of the best practice workflow for accurate mapping of tRNA reads. All annotated tRNAs were masked in the genome using BEDtools v2.27.1 6. To reduce an artificial increase in multiple mapping reads, sequence regions identical to the annotated tRNAs were also masked. To simulate the 5’-leader sequence and reduce softclipping artefacts, tRNA sequences were elongated with a 30 nt long 5’-genomic flanking region. Further, introns were removed and a 3’ CCACCA tail appended. The modified tRNA library was added as extra ‘chromosomes’ to the masked genome. The customized genome is referred to as the artificial genome. Reads were mapped to the artificial genomes using Segemehl v0.2.0-418 7. Due to the similarity of some short tRNA reads to, among others, repetitive regions in the genome, we considered an excessively high value of 100,000 mappings per seed. We allowed 3 mismatches in seed regions, requesting a minimal accuracy of 80% and increased the e-value of seed extensions to 500 to obtain highly modified tRNA reads. To analyze the specificity of the different RNA-Seq methods, the number of the unique tRNA mapped reads showing a 3’-CCA, -CC, -C as well as the absence of a 3’-CCA end were counted. Multiply mapped reads were counted as fraction of their number of hits or filtered to obtain uniquely mapped counts. |
| Organism/cell line | H. sapiens (HEK293T), Spinacia oleracea, Saccharomyces cerevisiae, Dictyostelium discoideum, Escherichia coli and Geobacillus stearothermophilus |
| Approximate experimental time | 5-6 days |
| Starting RNA amount | 2-4 µg total RNA |
| tRNA expression | ++ |
| Base modifications | (+) |
| Charging status | - |
| tRNA processing and fragmentation | - |
| Citation | https://doi.org/10.1080/15476286.2019.1664250 |
