We are using technical cookies that are necessary for page to work correctly.

Details for
SummaryThe extension of DM-tRNA-seq method determining fraction of charged isodecoders using periodate treatment followed by β-elimination.
Key findingsIn HEK293T cells, most cytosolic tRNAs are charged at >80% levels, whereas tRNASer and tRNAThr are charged at lower levels.
Sequencing strategyRNA-Seq
Raw datahttps://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE97259
Experimental protocolPeriodate oxidation of total RNA (final concentration = 1 μg/μl) was carried out in 100 mM NaOAc/HOAc, pH 4.8 and freshly prepared 50 mM NaIO4 at room temperature for 30 min. The reaction was quenched with 100 mM glucose for 5 min at room temperature. Any unquenched periodate was removed by Micro Bio-Spin P-6 Columns (Bio-Rad) and two ethanol precipitations. For β-elimination and deacylation, total RNA (final concentration = 1 μg/μl) was treated in 60 mM sodium borate, pH 9.5 at 45°C for 90 min. RNA was purified by Micro Bio-Spin P-6 Columns before ethanol precipitation. To purify tRNA, total RNA was then run on an 8% denaturing polyacryimide gel (7M Urea, 1× TBE), and tRNA was excised and eluted from the gel in 50 mM KOAc, 200 mM KCl. After ethanol precipitation, short RNA oligo standards were added in different proportions (final concentration = 0.4 pmol total/μg tRNA) to ensure that TGIRT extension from T- and G-ending primers are equivalent. The sequence of the oligo pairs are: first pair: 5′ GUAAUUAUACUCAUAAAUUCGUUGUACGUGAUGCCUAAUUCCUCCA, 5′ GUAAUUAUACUCAUAAAUUCGUUGUACGUGAUGCCUAAUUCCUCC; second pair: 5′ GCGGACUAGGUCCUGUGUUCGAUCCACAGAGUUCGCACCA, 5′ GCGGACUAGGUCCUGUGUUCGAUCCACAGAGUUCGCACC. In the first biological replicate, the oligos were added in a ratio of 75% 3′-CCA, 25% 3′-CC. In the second biological replicate, oligos were added in equal ratios (50% 3′-CCA, 50% 3′-CC). In the third biological replicate, oligos were added in a ratio of 25% 3′-CCA, 75% 3′-CC. The tRNA and model oligo mixture was used as input for DM-tRNA-seq.tRNA was demethylated under DM-tRNA-Seq optimized conditions. A total of 60 pmol of total tRNA was treated with 120 pmol WT AlkB and 240 pmol D135S AlkB in 25 mM MES, pH 5.0, 300 mM KCl, 2 mM MgCl2, 2 mM ascorbic acid, 300 μM α-ketoglutarate, 50 μM (NH4)2Fe(SO4)2 in the presence of RNAsin at room temperature for 2 h. A Zymo RNA Clean and Concentrator kit was used to remove the demethylases and clean up the reaction. Next, end repair (3′ phosphate removal) was performed. A total of 1 μM tRNA was treated with T4 polynucleotide kinase (PNK, Affymetrix) (final concentration = 0.2 U/μl) at 37°C for 30 min. A Zymo RNA Clean and Concentrator kit was again used to clean up the reaction. For cDNA synthesis, TGIRT primer was 5′ labeled with T4 PNK. A total of 4 pmol of each 5′ labeled TGIRT primer (T-ending: 5′ GATCGTCGGACTGTAGAACTAGACGTGTGCTCTTCCGATCTTTCAGGCATTAGGCTCAAAGT, G-ending: 5′ GATCGTCGGACTGTAGAACTAGACGTGTGCTCTTCCGATCTTTCAGGCATTAGGCTCAAAGG) was annealed to 8 pmol complementary RNA (5′ CUUUGAGCCUAAUGCCUGAAAGAUCGGAAGAGCACACGUCUAGUUCUACAGUCCGACGAUC/3SpC3/) in 100 mM Tris–HCl, pH 7.5, 0.5 mM EDTA at 82°C for 2 min, then slow cooled to room temperature. A total of 4 pmol tRNA was then added. The tRNA/primer mixture (200 nM tRNA, 200 nM each primer) was pre-incubated at room temperature for 30 min in 100 mM Tris–HCl, pH 7.5, 450 mM NaCl, 5 mM MgCl2, 5 mM DTT with 500 nM TGIRT (InGex, Inc.). dNTPs were added to a final concentration of 1 mM to initiate the reaction. The reverse transcription was performed at 60°C for 60 min. The reactions were terminated with additions of NaOH to 0.25 M and incubation at 95°C for 3 min. The reaction was neutralized with 0.25 M HCl. An equal volume of 50% Formamide, 4.5M Urea, 50 mM EDTA, 0.05% Bromophenol blue, 0.05% Xylene cyanol was added, and the mixture was heated at 95°C for 15 min. cDNAs were then purified by denaturing 10% PAGE (7M Urea, 1× TBE), and extended products were cut and eluted from the gel overnight in 50 mM KOAc, 200 mM KCl. Purified cDNA was ethanol precipitated with addition of linear acrylamide (Thermo) to 20 μg/ml. Purified cDNA was then circularized using CircLigase II (Epicentre) at 60°C overnight. After inactivation at 80°C for 10 min, samples were phenol/chloroform extracted and ethanol precipitated. Polymerase chain reaction (PCR) library preparation for Illumina sequencing was performed using Phusion Master Mix (Thermo) for 12 PCR cycles (98°C 5 s, 60°C 10 s, 72°C 10 s). AMPure XP Beads (Beckman-Coulter) were used to clean up the libraries before Illumina sequencing.
Analysis protocolStandard quality control via FastQC was performed after sequencing and also after read processing. Reads were processed using Trimmomatic v0.32 to remove the standard Illumina adapter sequence followed by subsequent trimming using custom Python scripts to remove demultiplexing artifacts, primers and trim the extended adapter. This second trimming step ensures that reads are not over-trimmed by Trimmomatic to ensure fidelity of the 3′ end of the raw reads. The resultant trimmed sequences were then aligned to the library using Bowtie 1.0 with sensitive options (–k 1 –v 3 –best –strata). Sequencing reads were aligned to a modified tRNA hg19 genome file, containing nuclear-encoded tRNAs, mitochondrial-encoded tRNAs and specific E. coli and yeast tRNAs used as standards. tRNA isodecoder abundance was determined by raw mapped read count for each isodecoder sequence. Because we condensed same-scoring tRNAs from the genomic tRNA database (17) into one sequence, we used only mapped read count for each isodecoder without normalization to the number of genes with the same sequence. Each read was mapped to a single isodecoder based on sequence identity. If a short read could potentially be mapped to multiple isodecoders, it is thrown out due to the mapping ambiguity. Because Bowtie 1.0 uses end-to-end alignment, the determination for charge ratio is as follows: an aligned read is considered A-ending/charged if it aligns with no mismatches to the tRNA’s 3′ 15 nt including the –CCA. Consequently, if the read aligns to the 3′ nt but only ends in –CC, it is considered C-ending/uncharged. Ratios were determined as individual fractional components over the sum of the A-ending and C-ending aligned reads.
Organism/cell lineHomo sapiens (HEK293T)
ConditionsAlkB-treated and untreated
Approximate experimental time3-4 days
Starting RNA amount10 µg total RNA
tRNA expression++
Base modifications+
Charging status+
tRNA processing and fragmentation-
Citationhttps://doi.org/10.1093/nar/gkx514