| Experimental protocol | Total RNA was extracted from cultured cells using TRIsure (Bioline) according to the manufacturer's protocol. Total RNAs were incubated at 37°C for 40 min in 20 mM Tris-HCl (pH 9.0) to remove amino acids from mature tRNAs (deacylation treatment), followed by ethanol precipitation. A DNA adapter containing Illumina 3΄-adapter sequences (Y-3΄-AD) and four different DNA/RNA hybrid adapters containing Illumina 5΄-adapter sequences and a 3΄-terminal A (Y-5΄-AD-A), G (Y-5΄-AD-G), C (Y-5΄-AD-C) or U (Y-5΄-AD-U) were synthesized by Integrated DNA Technologies. The adapter sequences were as follows (capital and small letters designate DNA and RNA, respectively): Y-3΄-AD, 5΄-5phos/GTATCCAGTTGGAATTCTCGGGTGCCAAGG/3ddC-3΄; Y-5΄-AD-A, 5΄-GTTCAGAGTTCTACAGTCCGACGATCACTGGATACTGga-3΄; Y-5΄-AD-G, 5΄-GTTCAGAGTTCTACAGTCCGACGATCACTGGATACTGgg-3΄; Y-5΄-AD-C, 5΄-GTTCAGAGTTCTACAGTCCGACGATCACTGGATACTGgc-3΄; and Y-5΄-AD-U, 5΄-GTTCAGAGTTCTACAGTCCGACGATCACTGGATACTGgu-3΄. The Y-shaped adapters comprising Y-3΄-AD/Y-5΄-AD-A, Y-3΄-AD/Y-5΄-AD-G, Y-3΄-AD/Y-5΄-AD-C and Y-3΄-AD/Y-5΄-AD-U are expected to hybridize mature tRNAs with discriminator bases of U, C, G and A, respectively. Four different Y-5΄-AD adapters (10 pmol each) and 40 pmol of the Y-3΄-AD adapter were incubated with 1 μg of deacylated total RNA in a 9-μl reaction volume at 90°C for 2 min. After adding 1 μl of 10× annealing buffer containing 50 mM Tris-HCl (pH 8.0), 5 mM ethylenediaminetetraacetic acid and 100 mM MgCl2, the 10-μl mixture was subjected to annealing at 37°C for 15 min. To ligate the annealed adapter to mature tRNAs, 10 μl of 1× reaction buffer containing 1 unit of Rnl2 (New England Biolabs) was added to the mixture. The entire mixture (20 μl) was incubated at 37°C for 1 h, followed by overnight incubation at 4°C. cDNA amplification was performed using the TruSeq Small RNA Sample Preparation Kit (Illumina) according to the manufacturer's protocol. Briefly, 6 μl of ligated RNA and 1 μl of RTP primer were incubated at 70°C for 2 min and then placed on ice. Reverse transcription was subsequently performed by adding 5.5 μl of a RT reaction mixture comprising 2 μl of 5× First Strand Buffer, 0.5 μl of 12.5 mM each dNTP, 1 μl of 100 mM dithiothreitol, 1 μl of RNase inhibitor and 1 μl of SuperScript III Reverse Transcriptase (Life Technologies), followed by incubation at 55°C for 60 min. The resultant cDNAs were amplified by polymerase chain reaction (PCR) (11 cycles) using a PCR enzyme mix (PML) and primers included in the Illumina kit. PCR products were developed using 8% native polyacrylamide gel electrophoresis (PAGE), and mature tRNA amplified regions were gel-purified. To confirm the amplified cDNA sequences, purified cDNAs were cloned using StrataClone Blunt PCR Cloning Kit (Agilent Technologies). The cDNAs were further sequenced (100 nt single-read) on an Illumina HiSeq 2500. |
