tdbR00000600

Name	Value
Coding AA:	Sec
Anticodon sequence:	1CA
Organism:	Drosophila melanogaster NCBI:txid7227
RNA type:	cytoplasmic
Sequence:	GCCCCACUGAACUUCGGUGGUCCGGGGUGCGGACU1CA+AUCCGUAGUCGAUUUGCGUCGAAGUGGUPCGAUUCCACCUGGGGGGCGCCA
Unmodified sequence:	GCCCCACUGAACUUCGGUGGUCCGGGGUGCGGACUUCAAAUCCGUAGUCGAUUUGCGUCGAAGUGGUUCGAUUCCACCUGGGGGGCGCCA
Secondary structure:	(((((.(....((((........)))).(((((.......)))))................(((((.......)))).)).)))))....
Homology model or structure extracted from PDB:	Model (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	unversioned, created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-18.30
Pre-aligned sequence: Pre-aligned secondary structure:	-GCCCCACU_CUUCGGU--GGU-CCGGGGUGCGGACU1CA+AUCCGUAGUCGAU--UUGC---GUCGA---AGUGGUPCGAUUCCA_UGGGGGGCGCCA .(((((.(..((((...........)))).(((((.......)))))........................(.(((.......))).)).)))))....
Publications:	Selenocysteine tRNA[Ser]Sec gene is ubiquitous within the animal kingdom. B J Lee, M Rajagopalan, Y S Kim, K H You, K B Jacobson, D Hatfield Molecular and cellular biology volume: 10 issue: 5 PUBMED ID: 2139169 Selenium metabolism in Drosophila. Characterization of the selenocysteine tRNA population. X Zhou, S I Park, M E Moustafa, B A Carlson, P F Crain, A M Diamond, D L Hatfield, B J Lee The Journal of biological chemistry volume: 274 issue: 26 PUBMED ID: 10373487 Unique secondary and tertiary structural features of the eucaryotic selenocysteine tRNA(Sec). C Sturchler, E Westhof, P Carbon, A Krol Nucleic acids research volume: 21 issue: 5 PUBMED ID: 8464694 Eukaryotic selenocysteine tRNA has the 9/4 secondary structure. T Mizutani, C Goto FEBS letters volume: 466 issue: 2-3 PUBMED ID: 10682860
Previous entry:	tdbR00000600 (Sept. 22, 2019, 6:01 p.m.)