We are using technical cookies that are necessary for page to work correctly.

tdbR00000600

NameValue
Coding AA: Sec
Anticodon sequence: 1CA
Organism: Drosophila melanogaster NCBI:txid7227
RNA type: cytoplasmic
Sequence: GCCCCACUGAACUUCGGUGGUCCGGGGUGCGGACU1CA+AUCCGUAGUCGAUUUGCGUCGAAGUGGUPCGAUUCCACCUGGGGGGCGCCA
Unmodified sequence: GCCCCACUGAACUUCGGUGGUCCGGGGUGCGGACUUCAAAUCCGUAGUCGAUUUGCGUCGAAGUGGUUCGAUUCCACCUGGGGGGCGCCA
Secondary structure: (((((.(....((((........)))).(((((.......)))))................(((((.......)))).)).)))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: unversioned, created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -18.30
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCCCCACU_CUUCGGU--GGU-CCGGGGUGCGGACU1CA+AUCCGUAGUCGAU--UUGC---GUCGA---AGUGGUPCGAUUCCA_UGGGGGGCGCCA
.(((((.(..((((...........)))).(((((.......)))))........................(.(((.......))).)).)))))....
Publications:
  • Selenocysteine tRNA[Ser]Sec gene is ubiquitous within the animal kingdom.
    B J Lee, M Rajagopalan, Y S Kim, K H You, K B Jacobson, D Hatfield
    Molecular and cellular biology
    volume: 10 issue: 5 PUBMED ID: 2139169
  • Selenium metabolism in Drosophila. Characterization of the selenocysteine tRNA population.
    X Zhou, S I Park, M E Moustafa, B A Carlson, P F Crain, A M Diamond, D L Hatfield, B J Lee
    The Journal of biological chemistry
    volume: 274 issue: 26 date: June 25, 1999 PUBMED ID: 10373487
  • Unique secondary and tertiary structural features of the eucaryotic selenocysteine tRNA(Sec).
    C Sturchler, E Westhof, P Carbon, A Krol
    Nucleic acids research
    volume: 21 issue: 5 date: March 11, 1993 PUBMED ID: 8464694
  • Eukaryotic selenocysteine tRNA has the 9/4 secondary structure.
    T Mizutani, C Goto
    FEBS letters
    volume: 466 issue: 2-3 date: Jan. 28, 2000 PUBMED ID: 10682860
Previous entry: tdbR00000600 (Sept. 22, 2019, 6:01 p.m.)

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer