tdbR00000404

Name	Value
Coding AA:	Ser
Anticodon sequence:	GCU
Organism:	Homo sapiens NCBI:txid9606
RNA type:	mitochondrial
Sequence:	GAGAAAGCUCACAAGAACUGCU6ACUCAUGCCCCCAUGUCUAACAACAUGGCUUUCUCACCA
Unmodified sequence:	GAGAAAGCUCACAAGAACUGCUAACUCAUGCCCCCAUGUCUAACAACAUGGCUUUCUCACCA
Secondary structure:	(((((((....((.((.........)).))...((..............)))))))))....
Homology model or structure extracted from PDB:	Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	unversioned, created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-4.10
Pre-aligned sequence: Pre-aligned secondary structure:	-GAGAAAG-C----------------UCACAAGAACUGCU6ACUCAUGCCC--------------------CCAUGUCUAAC_CAUGGCUUUCUCACCA .(((((((.....................((.((.........)).)).......................((.............)))))))))....
Publications:	A mammalian mitochondrial serine transfer RNA lacking the "dihydrouridine" loop and stem. M H de Bruijn, P H Schreier, I C Eperon, B G Barrell, E Y Chen, P W Armstrong, J F Wong, B A Roe Nucleic acids research volume: 8 issue: 22 date: Nov. 25, 1980 PUBMED ID: 6906662
Previous entry:	tdbR00000404 (Sept. 22, 2019, 6:04 p.m.)

Model based on:

RNA Composer