We are using technical cookies that are necessary for page to work correctly.

tdbR00000404

NameValue
Coding AA: Ser
Anticodon sequence: GCU
Organism: Homo sapiens NCBI:txid9606
RNA type: mitochondrial
Sequence: GAGAAAGCUCACAAGAACUGCU6ACUCAUGCCCCCAUGUCUAACAACAUGGCUUUCUCACCA
Unmodified sequence: GAGAAAGCUCACAAGAACUGCUAACUCAUGCCCCCAUGUCUAACAACAUGGCUUUCUCACCA
Secondary structure: (((((((....((.((.........)).))...((..............)))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 3 (June 29, 2026), created: Feb. 25, 2019, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -4.10
Pre-aligned sequence:
Pre-aligned secondary structure:
-GAGAAAG-C----------------UCACAAGAACUGCU6ACUCAUGCCC--------------------CCAUGUCUAAC_CAUGGCUUUCUCACCA
.(((((((.....................((.((.........)).)).......................((.............)))))))))....
Variants & Diseases: m.12258C>A, MT-TS2 (mt-tRNA^Ser(AGY)), Mitochondrial diabetes; retinitis pigmentosa with progressive sensorineural hearing loss
Publications:
  • A mammalian mitochondrial serine transfer RNA lacking the "dihydrouridine" loop and stem.
    M H de Bruijn, P H Schreier, I C Eperon, B G Barrell, E Y Chen, P W Armstrong, J F Wong, B A Roe
    Nucleic acids research
    volume: 8 issue: 22 date: Nov. 25, 1980 PUBMED ID: 6906662
Previous entry: tdbR00000404 (Sept. 22, 2019, 6:04 p.m.)

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer