tdbR00000601

Name	Value
Coding AA:	Pyr
Anticodon sequence:	CUA
Organism:	Methanosarcina barkeri NCBI:txid2208
RNA type:	cytoplasmic
Sequence:	GGAAACC4GAUCAUGUAGAUCGAAUGGACUCUAAAUCCGUUCAGCCGGG]UAGAUUCCCGGGGUUUCCGCCA
Unmodified sequence:	GGAAACCUGAUCAUGUAGAUCGAAUGGACUCUAAAUCCGUUCAGCCGGGUUAGAUUCCCGGGGUUUCCGCCA
Secondary structure:	(((((((.((((.....)))).((((((.......))))))...(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	unversioned, created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-26.20
Pre-aligned sequence: Pre-aligned secondary structure:	-GGAAACC4-GAUCA-U--G-U--AGAUCG_UGGACUCUAAAUCCG_CA---------------------GCCGGG]UAGAUUCCCGGGGUUUCCGCCA .(((((((..((((...........))))..((((.......)))).........................(((((.......))))))))))))....
Publications:	An aminoacyl-tRNA synthetase that specifically activates pyrrolysine. Carla Polycarpo, Alexandre Ambrogelly, Amélie Bérubé, SusAnn M Winbush, James A McCloskey, Pamela F Crain, John L Wood, Dieter Söll Proceedings of the National Academy of Sciences of the United States of America volume: 101 issue: 34 date: Aug. 24, 2004 epub: Aug. 16, 2004 PUBMED ID: 15314242
Previous entry:	tdbR00000601 (Sept. 22, 2019, 6:10 p.m.)

Model based on:

RNA Composer