We are using technical cookies that are necessary for page to work correctly.

tdbR00000599

NameValue
Coding AA: Sec
Anticodon sequence: 1CA
Organism: Xenopus laevis NCBI:txid8355
RNA type: cytoplasmic
Sequence: GCCCGGAUGACCCUCAGUGGUCUGGGGUGCAGGCU1CA+ACCUGUAGCUGUCUAGCGACAGAGUGGUPCA"UUCCACCUUUCGGGCGCCA
Unmodified sequence: GCCCGGAUGACCCUCAGUGGUCUGGGGUGCAGGCUUCAAACCUGUAGCUGUCUAGCGACAGAGUGGUUCAAUUCCACCUUUCGGGCGCCA
Secondary structure: (((((((....((((........)))).(((((.......)))))................(((((.......)))).))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: unversioned, created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -22.50
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCCCGGAU_CCUCAGU--GGU-CUGGGGUGCAGGCU1CA+ACCUGUAGCUGUC--UAGC---GACAG---AGUGGUPCA"UUCCA_UUUCGGGCGCCA
.(((((((..((((...........)))).(((((.......)))))........................(.(((.......))).))))))))....
Publications:
  • Selenocysteine tRNA[Ser]Sec gene is ubiquitous within the animal kingdom.
    B J Lee, M Rajagopalan, Y S Kim, K H You, K B Jacobson, D Hatfield
    Molecular and cellular biology
    volume: 10 issue: 5 PUBMED ID: 2139169
  • Base modification pattern at the wobble position of Xenopus selenocysteine tRNA(Sec).
    C Sturchler, A Lescure, G Keith, P Carbon, A Krol
    Nucleic acids research
    volume: 22 issue: 8 date: April 25, 1994 PUBMED ID: 8031393
Previous entry: tdbR00000599 (Sept. 22, 2019, 6:17 p.m.)

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer