tdbR00000986

Name	Value
Coding AA:	Arg
Anticodon sequence:	UCG
Organism:	Homo sapiens NCBI:txid9606
RNA type:	cytoplasmic
Sequence:	GGCCGU;UGGCCUAAUGGAUAAGGCGUCUGABU3CGGAU°AAAAGADUQCAGGUUUGHGUUCUGCCACGGUCGCCA
Unmodified sequence:	GGCCGUGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAAAAGAUUGCAGGUUUGAGUUCUGCCACGGUCGCCA
Secondary structure:	(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	User
Version:	unversioned, created: March 20, 2020, modified: July 2, 2025
Folding free energy [kcal/mol]:	-21.70
Pre-aligned sequence: Pre-aligned secondary structure:	-GGCCGU;UGGCCUAAU--GGAU-AAGGCGUCUGABU3CGGAU°AAAAG-------------------ADUQCAGGUUUGHGUUCUGCCACGGUCGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	A computational platform for high-throughput analysis of RNA sequences and modifications by mass spectrometry. Samuel Wein, Byron Andrews, Timo Sachsenberg, Helena Santos-Rosa, Oliver Kohlbacher, Tony Kouzarides, Benjamin A Garcia, Hendrik Weisser Nature communications volume: 11 issue: 1 date: Feb. 17, 2020 epub: Feb. 17, 2020 PUBMED ID: 32066737 DOI: 926
Comments:	Position 7 is monomethylated G (base or sugar). At position 34 could be also mchm5U. At position 40 could be also hm5Cm. Position 58 is monomethylated A (base).

Model based on:

RNA Composer