We are using technical cookies that are necessary for page to work correctly.

tdbR00000986

NameValue
Coding AA: Arg
Anticodon sequence: UCG
Organism: Homo sapiens NCBI:txid9606
RNA type: cytoplasmic
Sequence: GGCCGU;UGGCCUAAUGGAUAAGGCGUCUGABU3CGGAU°AAAAGADUQCAGGUUUGHGUUCUGCCACGGUCGCCA
Unmodified sequence: GGCCGUGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAAAAGAUUGCAGGUUUGAGUUCUGCCACGGUCGCCA
Secondary structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: User
Version: unversioned, created: March 20, 2020, modified: July 2, 2025
Folding free energy [kcal/mol]: -21.70
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGCCGU;UGGCCUAAU--GGAU-AAGGCGUCUGABU3CGGAU°AAAAG-------------------ADUQCAGGUUUGHGUUCUGCCACGGUCGCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • A computational platform for high-throughput analysis of RNA sequences and modifications by mass spectrometry.
    Samuel Wein, Byron Andrews, Timo Sachsenberg, Helena Santos-Rosa, Oliver Kohlbacher, Tony Kouzarides, Benjamin A Garcia, Hendrik Weisser
    Nature communications
    volume: 11 issue: 1 date: Feb. 17, 2020 epub: Feb. 17, 2020 PUBMED ID: 32066737 DOI: 926
Comments: Position 7 is monomethylated G (base or sugar). At position 34 could be also mchm5U. At position 40 could be also hm5Cm. Position 58 is monomethylated A (base).

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer