We are using technical cookies that are necessary for page to work correctly.

tdbR00000010 (deprecated)

NameValue
Coding AA: Ala
Anticodon sequence: VGC
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGGGCUA4AGCUCAGCDGGGAGAGCGCCUGCUUVGCACGCAGGAG7UCUGCGGTPCGAUCCCGCAUAGCUCCACCA
Unmodified sequence: GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA
Secondary structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 3 (June 29, 2026), created: Feb. 25, 2019, modified: Aug. 17, 2026
Folding free energy [kcal/mol]: -29.20
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGGGCUA4AGCUCAGCD-GGG--AGAGCGCCUGCUUVGCACGCAGGAG-------------------7UCUGCGGTPCGAUCCCGCAUAGCUCCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Spacer transfer RNAs in ribosomal RNA transcripts of E. coli: processing of 30S ribosomal RNA in vitro.
    E Lund, J E Dahlberg
    Cell
    volume: 11 issue: 2 PUBMED ID: 329997
Comments: At position 32 could be also Um () At position 34 could be also mcmo5U
Previous entry: tdbR00000010 (March 25, 2020, 1:11 p.m.)
Next entry: tdbR00000010 (Aug. 17, 2026, 11:39 a.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: A73; G2-C71; G3-U70; G4-C69; G20
Negative identity elements antideterminants of aminoacylation: G3-U70 also functions as a negative/orthogonalizing element against some non-Ala systems; in yeast ThrRS context, G3-U70 in tRNAAla acts as an antideterminant for ThrRS.
Citation: Choi,H., Otten,S. and McClain,W.H. (2002) Isolation of novel tRNAAla mutants by library selection in a tRNAAla knockout strain. Biochimie, 84, 705–711.
DOI: 10.1016/S0300-9084(02)01407-4
PMID: 12457558

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer