tdbR00000010 (deprecated)
| Name | Value |
|---|---|
| Coding AA: | Ala |
| Anticodon sequence: | VGC |
| Organism: | Escherichia coli NCBI:txid562 |
| RNA type: | cytoplasmic |
| Sequence: | GGGGCUA4AGCUCAGCDGGGAGAGCGCCUGCUUVGCACGCAGGAG7UCUGCGGTPCGAUCCCGCAUAGCUCCACCA |
| Unmodified sequence: | GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA |
| Secondary structure: | (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 3 (June 29, 2026), created: Feb. 25, 2019, modified: Aug. 17, 2026 |
| Folding free energy [kcal/mol]: | -29.20 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGGGCUA4AGCUCAGCD-GGG--AGAGCGCCUGCUUVGCACGCAGGAG-------------------7UCUGCGGTPCGAUCCCGCAUAGCUCCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
| Comments: | At position 32 could be also Um () At position 34 could be also mcmo5U |
| Previous entry: | tdbR00000010 (March 25, 2020, 1:11 p.m.) |
| Next entry: | tdbR00000010 (Aug. 17, 2026, 11:39 a.m.) |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | A73; G2-C71; G3-U70; G4-C69; G20 |
| Negative identity elements antideterminants of aminoacylation: | G3-U70 also functions as a negative/orthogonalizing element against some non-Ala systems; in yeast ThrRS context, G3-U70 in tRNAAla acts as an antideterminant for ThrRS. |
| Citation: | Choi,H., Otten,S. and McClain,W.H. (2002) Isolation of novel tRNAAla mutants by library selection in a tRNAAla knockout strain. Biochimie, 84, 705–711. |
| DOI: | 10.1016/S0300-9084(02)01407-4 |
| PMID: | 12457558 |
Secondary structure
Tertiary structure
Model based on:
