tdbR00000181
| Name | Value |
|---|---|
| Coding AA: | Lys |
| Anticodon sequence: | SUU |
| Organism: | Escherichia coli NCBI:txid562 |
| RNA type: | cytoplasmic |
| Sequence: | GGGUCGUUAGCUCAGDDGGDAGAGCAGUUGACUSUUeAPCAAUUG7XCGCAGGTPCGAAUCCUGCACGACCCACCA |
| Unmodified sequence: | GGGUCGUUAGCUCAGUUGGUAGAGCAGUUGACUUUUAAUCAAUUGGUCGCAGGUUCGAAUCCUGCACGACCCACCA |
| Secondary structure: | (((((((..((((........))))((((((.......))))))....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 3 (June 29, 2026), created: Feb. 25, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -27.10 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGGUCGUUAGCUCAGDD-GGD--AGAGCAGUUGACUSUUeAPCAAUUG-------------------7XCGCAGGTPCGAAUCCUGCACGACCCACCA .(((((((..((((...........))))((((((.......)))))).......................(((((.......)))))))))))).... |
| Publications: |
|
| Comments: | Modified nucleoside at position 37 - ct6A - was previously identified as t6A, probably due to isolation conditions |
| Previous entry: | tdbR00000181 (March 26, 2020, 10:26 a.m.) |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | A73; U34; U35; U36 |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | Martin,F., Reinbolt,J., Dirheimer,G., Gangloff,J. and Eriani,G. (1996) Selection of tRNAAsp amber suppressor mutants having alanine, arginine, glutamine, and lysine identity. RNA, 2, 919–927. |
| PMID: | 8809018 |
Secondary structure
Tertiary structure
Model based on: