We are using technical cookies that are necessary for page to work correctly.

tdbR00001010 (deprecated)

NameValue
Coding AA: Trp
Anticodon sequence: CCA
Organism: Staphylococcus aureus NCBI:txid1280
RNA type: cytoplasmic
Sequence: AGGGGCAUAGUUCAACGGUAGAAUAGAGGUCUCCAAAACCUUUGGUGUGGGUUCGAUUCCUACUGCCCUGCCA
Unmodified sequence: AGGGGCAUAGUUCAACGGUAGAAUAGAGGUCUCCAAAACCUUUGGUGUGGGUUCGAUUCCUACUGCCCUGCCA
Secondary structure: (((((((..((((.......))))((((((.......))))))...(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model (last update May 21, 2020)
Prepared by: User
Version: unversioned, created: May 21, 2020, modified: Nov. 7, 2024
Folding free energy [kcal/mol]: 100000.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-AGGGGCAUAGUUCAAC--GGU--AGAAUAGAGGUCUCCAAAACCUUUG-------------------G-UGUGGGUUCGAUUCCUACUGCCCCUGCCA
.(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:
  • MODOMICS: a database of RNA modification pathways. 2017 update.
    Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki
    Nucleic acids research
    volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030
Next entry: tdbR00001010 (July 2, 2025, 2:55 p.m.)

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on: