tdbR00001020

Name	Value
Coding AA:	Glu
Anticodon sequence:	SUC
Organism:	Vibrio cholerae C6706 NCBI:txid948564
RNA type:	cytoplasmic
Sequence:	GUCCCGUUCGUCUAGAGGCCŁAGGACACCGCCCUSUCAC#GCGGUAACAGGGGTUCGACUCCCCUACGGGAUACCA
Unmodified sequence:	GUCCCGUUCGUCUAGAGGCCUAGGACACCGCCCUUUCACGGCGGUAACAGGGGUUCGACUCCCCUACGGGAUACCA
Secondary structure:	(((((((..((((.........))))((((((.......))))))...(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	User
Version:	unversioned, created: Oct. 29, 2020, modified: July 2, 2025
Folding free energy [kcal/mol]:	-29.70
Pre-aligned sequence: Pre-aligned secondary structure:	-GUCCCGUUCGUCUAGA--GGCCŁAGGACACCGCCCUSUCAC#GCGGUA-------------------A-CAGGGGTUCGACUCCCCUACGGGAUACCA .(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:	MODOMICS: a database of RNA modification pathways. 2017 update. Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki Nucleic acids research volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030
Comments:	Ł is acetylated acp3U (acacp3U). At the moment when record is added there is no abbreviation for this modification in MODOMICS database

Model based on:

RNA Composer