We are using technical cookies that are necessary for page to work correctly.

tdbR00000183

NameValue
Coding AA: Lys
Anticodon sequence: $UU
Organism: Saccharomyces cerevisiae NCBI:txid4932
RNA type: mitochondrial
Sequence: GAGAAUAUUGUUUAADGGDAAAACAGPUGPCU$UU6AGCAACCCAUGCUGGTPCAACUCCAGCUAUUCUCACCA
Unmodified sequence: GAGAAUAUUGUUUAAUGGUAAAACAGUUGUCUUUUAAGCAACCCAUGCUGGUUCAACUCCAGCUAUUCUCACCA
Secondary structure: (((((((..((((.......)))).(((((.......)))))....((.((.......)).)))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: unversioned, created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -12.40
Pre-aligned sequence:
Pre-aligned secondary structure:
-GAGAAUAUUGUUUAAU--GGU--AAAACAGUUGUCUUUUAAGCAACCCAU--------------------GCUGGUUCAACUCCAGCUAUUCUCACCA
.(((((((..((((...........)))).(((((.......)))))........................((.((.......)).)))))))))....
Publications:
  • MODOMICS: a database of RNA modification pathways. 2017 update.
    Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki
    Nucleic acids research
    volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030
  • Codon reading patterns in Saccharomyces cerevisiae mitochondria based on sequences of mitochondrial tRNAs.
    A P Sibler, G Dirheimer, R P Martin
    FEBS letters
    volume: 194 issue: 1 date: Jan. 1, 1986 PUBMED ID: 2416594
Previous entry: tdbR00000183 (Nov. 8, 2024, 10:53 a.m.)

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer