tdbR00000630

Name	Value
Coding AA:	Ala
Anticodon sequence:	HGC
Organism:	Homo sapiens NCBI:txid9606
RNA type:	cytoplasmic
Sequence:	GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUHGCHUGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCCACCA
Unmodified sequence:	GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCGCAUUCUCCACCA
Secondary structure:	(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	unversioned, created: May 30, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-29.60
Pre-aligned sequence: Pre-aligned secondary structure:	-GGGGAAUUAGCUCAAAU-GGU--AGAGCGCUCGCUUHGCHUGCGAGAG-------------------GUAGCGGGAUCGAUGCCCGCAUUCUCCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP. Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl Cell reports volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: 10.1016/j.celrep.2017.07.029
Comments:	Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAAla in HEK293 cells: 4.8%
Previous entry:	tdbR00000630 (Nov. 8, 2024, 1:32 p.m.)

Model based on:

Moderna

RNA Composer