| Coding AA: |
Lys |
| Anticodon sequence: |
SUU |
| Organism: |
Escherichia coli
NCBI:txid562
|
| RNA type: |
cytoplasmic |
| Sequence: |
GGGUCGUUAGCUCAGDDGGDAGAGCAGUUGACUSUU6APCAAUUG7XCGCAGGTPCGAAUCCUGCACGACCCACCA |
| Unmodified sequence: |
GGGUCGUUAGCUCAGUUGGUAGAGCAGUUGACUUUUAAUCAAUUGGUCGCAGGUUCGAAUCCUGCACGACCCACCA |
| Secondary structure: |
(((((((..((((........))))((((((........))))))...(((((.......)))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-18.70 |
| Variants & Diseases: |
|
| Publications: |
- Correction: Glutamate sensing in biofluids: recent advances and research challenges of electrochemical sensors.
Jessica Schultz, Zakir Uddin, Gurmit Singh, Matiar M R Howlader
The Analyst
volume: 145
issue: 12
date: June 15, 2020
PUBMED ID: 32432607
DOI: 10.1039/d0an90050h
|