| Coding AA: |
Sec |
| Anticodon sequence: |
1CA |
| Organism: |
Homo sapiens
NCBI:txid9606
|
| RNA type: |
cytoplasmic |
| Sequence: |
GCCCGGAUGAUCCUCAGUGGUCUGGGGUGCAGGCU1CAЧACCUGUAGCUGUCUAGCGACAGAGUGGUPCAѢUUCCACCUUUCGGGCGCCA |
| Unmodified sequence: |
GCCCGGAUGAUCCUCAGUGGUCUGGGGUGCAGGCUUCAAACCUGUAGCUGUCUAGCGACAGAGUGGUUCAAUUCCACCUUUCGGGCGCCA |
| Secondary structure: |
(((((((((..((((((....))))))((((((.......))))))((((((....))))))((((.......))))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-40.10 |
| Variants & Diseases: |
C65G, Sec-TCA, Euthyroid hyperthyroxinemia; selenium deficiency (only homozygous mutations) |
| Publications: |
- Regulation of A-to-I RNA editing and stop codon recoding to control selenoprotein expression during skeletal myogenesis.
Yuta Noda, Shunpei Okada, Tsutomu Suzuki
Nature communications
volume: 13
issue: 1
date: May 6, 2022
epub: May 6, 2022
PUBMED ID: 35523818
DOI: 2503
|
| Comments: |
mcm5U34 can also be an mcm5Um34, depending on the Se availability and its level differed |