| Coding AA: |
Ile |
| Anticodon sequence: |
LAU |
| Organism: |
Bacillus subtilis
NCBI:txid1423
|
| RNA type: |
cytoplasmic |
| Sequence: |
GGACCUUUAGCUCAGUDGGDDAGAGCAGACGGCULAUЖACCGUCCG7UCGUAGGTPCGAGUCCUACAAGGUCCACCA |
| Unmodified sequence: |
GGACCUUUAGCUCAGUUGGUUAGAGCAGACGGCUGAUAACCGUCCGGUCGUAGGUUCGAGUCCUACAAGGUCCACCA |
| Secondary structure: |
(((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-27.20 |
| Variants & Diseases: |
|
| Publications: |
- Life without tRNAIle-lysidine synthetase: translation of the isoleucine codon AUA in Bacillus subtilis lacking the canonical tRNA2Ile.
Caroline Köhrer, Debabrata Mandal, Kirk W Gaston, Henri Grosjean, Patrick A Limbach, Uttam L Rajbhandary
Nucleic acids research
volume: 42
issue: 3
epub: Nov. 4, 2013
PUBMED ID: 24194599
DOI: 10.1093/nar/gkt1009
|