| Coding AA: |
Lys |
| Anticodon sequence: |
3UU |
| Organism: |
Homo sapiens
NCBI:txid9606
|
| RNA type: |
cytoplasmic |
| Sequence: |
GCCCLGAUɿGCUCAGDCGGDAGAGCAUCAGACU3UU[APCUGAGG7U??AGGGTPCAѢGUCCCUGUUCGGCGCCA |
| Unmodified sequence: |
GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGCGCCA |
| Secondary structure: |
(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-18.90 |
| Variants & Diseases: |
|
| Publications: |
- Silencing of the tRNA Modification Enzyme Cdkal1 Effects Functional Insulin Synthesis in NIT-1 Cells: tRNA
Amithi Narendran, Sweta Vangaveti, Srivathsan V Ranganathan, Emily Eruysal, Miranda Craft, Omar Alrifai, Fu Yee Chua, Kathryn Sarachan, Breann Litwa, Sheetal Ramachandran, Paul F Agris
Frontiers in molecular biosciences
volume: 7
epub: Feb. 9, 2021
PUBMED ID: 33634165
DOI: 584228
|