tdbR00001110

Name	Value
Coding AA:	Phe
Anticodon sequence:	#AA
Organism:	Saccharomyces cerevisiae NCBI:txid4932
RNA type:	unknown
Sequence:	GCGGAUUUALCUCAGDDGGGAGAGCRCCAGABU#AAYAP?UGGAG7UC?UGUGTPCGѢUCCACAGAAUUCGCACCA
Unmodified sequence:	GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA
Secondary structure:	(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Prepared by:	Database creators
Version:	3 (June 29, 2026), created: June 29, 2026, modified: Aug. 11, 2026
Folding free energy [kcal/mol]:	-22.40
Pre-aligned sequence: Pre-aligned secondary structure:	-GCGGAUUUALCUCAGDD-GGG--AGAGCRCCAGABU#AAYAP?UGGAG7UC-------------------?UGUGTPCGѢUCCACAGAAUUCGCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Direct Sequencing of tRNA by 2D-HELS-AA MS Seq Reveals Its Different Isoforms and Dynamic Base Modifications. Ning Zhang, Shundi Shi, Xuanting Wang, Wenhao Ni, Xiaohong Yuan, Jiachen Duan, Tony Z Jia, Barney Yoo, Ashley Ziegler, James J Russo, Wenjia Li, Shenglong Zhang ACS chemical biology volume: 15 issue: 6 date: June 19, 2020 epub: May 19, 2020 PUBMED ID: 32364699 DOI: 10.1021/acschembio.0c00119
Comments:	Article contains informations about the percentage of modifications on each modified position, organism mentioned: brewer’s yeast