| Coding AA: |
Phe |
| Anticodon sequence: |
#AA |
| Organism: |
Saccharomyces cerevisiae
NCBI:txid4932
|
| RNA type: |
unknown |
| Sequence: |
GCGGAUUUALCUCAGDDGGGAGAGCRCCAGABU#AAYAP?UGGAG7UC?UGUGTPCGѢUCCACAGAAUUCGCACCA |
| Unmodified sequence: |
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA |
| Secondary structure: |
(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-22.40 |
| Variants & Diseases: |
|
| Publications: |
- Direct Sequencing of tRNA by 2D-HELS-AA MS Seq Reveals Its Different Isoforms and Dynamic Base Modifications.
Ning Zhang, Shundi Shi, Xuanting Wang, Wenhao Ni, Xiaohong Yuan, Jiachen Duan, Tony Z Jia, Barney Yoo, Ashley Ziegler, James J Russo, Wenjia Li, Shenglong Zhang
ACS chemical biology
volume: 15
issue: 6
date: June 19, 2020
epub: May 19, 2020
PUBMED ID: 32364699
DOI: 10.1021/acschembio.0c00119
|
| Comments: |
Article contains informations about the percentage of modifications on each modified position, organism mentioned: brewer’s yeast |