We are using technical cookies that are necessary for page to work correctly.

tdbR00001111

NameValue
Coding AA: Met
Anticodon sequence: MAU
Organism: Vibrio cholerae NCBI:txid1854
RNA type: cytoplasmic
Sequence: GGCUACG4AGCUCAGUUGGDDAGAGCACAUCACUMAUeAUGAUGGG7XCACAGGTPCAAAUCCCGUCGUAGCCACCA
Unmodified sequence: GGCUACGUAGCUCAGUUGGUUAGAGCACAUCACUCAUAAUGAUGGGGUCACAGGUUCAAAUCCCGUCGUAGCCACCA
Secondary structure: (((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....
Prepared by: Database creators
Version: 3 (June 29, 2026), created: June 29, 2026, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -23.30
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGCUACG4AGCUCAGUU-GGDD-AGAGCACAUCACUMAUeAUGAUGGG7XC-------------------ACAGGTPCAAAUCCCGUCGUAGCCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Comparative tRNA sequencing and RNA mass spectrometry for surveying tRNA modifications.
    Satoshi Kimura, Peter C Dedon, Matthew K Waldor
    Nature chemical biology
    volume: 16 issue: 9 epub: June 8, 2020 PUBMED ID: 32514182 DOI: 10.1038/s41589-020-0558-1
Comments: At the position 47 there was a higher misincorporation frequency in samples from bacteria in the log phase in comparison to stationary phase, in Escherichia coli the tendency was reversed. For V. cholerae samples from cecal fluid of the infected infant rabits, the misincorporation and termination were similar to those from the log phase

Secondary structure

Your browser does not support the canvas element.