| Coding AA: |
Met |
| Anticodon sequence: |
MAU |
| Organism: |
Vibrio cholerae
NCBI:txid1854
|
| RNA type: |
cytoplasmic |
| Sequence: |
GGCUACG4AGCUCAGUUGGDDAGAGCACAUCACUMAUeAUGAUGGG7XCACAGGTPCAAAUCCCGUCGUAGCCACCA |
| Unmodified sequence: |
GGCUACGUAGCUCAGUUGGUUAGAGCACAUCACUCAUAAUGAUGGGGUCACAGGUUCAAAUCCCGUCGUAGCCACCA |
| Secondary structure: |
(((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-23.30 |
| Variants & Diseases: |
|
| Publications: |
- Comparative tRNA sequencing and RNA mass spectrometry for surveying tRNA modifications.
Satoshi Kimura, Peter C Dedon, Matthew K Waldor
Nature chemical biology
volume: 16
issue: 9
epub: June 8, 2020
PUBMED ID: 32514182
DOI: 10.1038/s41589-020-0558-1
|
| Comments: |
At the position 47 there was a higher misincorporation frequency in samples from bacteria in the log phase in comparison to stationary phase, in Escherichia coli the tendency was reversed. For V. cholerae samples from cecal fluid of the infected infant rabits, the misincorporation and termination were similar to those from the log phase |