| Coding AA: |
Tyr |
| Anticodon sequence: |
QUA |
| Organism: |
Vibrio cholerae
NCBI:txid1854
|
| RNA type: |
cytoplasmic |
| Sequence: |
GGAGGGG44CCCGAGDGGCCAAѢGGGAGCAGAPUQUA≠APCUGCCGGCUCCGCCUUCGAUGGTPCGAAUCCGUCCCCCUCCACCA |
| Unmodified sequence: |
GGAGGGGUUCCCGAGUGGCCAAAGGGAGCAGAUUGUAAAUCUGCCGGCUCCGCCUUCGAUGGUUCGAAUCCGUCCCCCUCCACCA |
| Secondary structure: |
(((((((..(((...........))).(((((.......))))).(((...)))...((.((.......)).))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-28.40 |
| Variants & Diseases: |
|
| Publications: |
- Comparative tRNA sequencing and RNA mass spectrometry for surveying tRNA modifications.
Satoshi Kimura, Peter C Dedon, Matthew K Waldor
Nature chemical biology
volume: 16
issue: 9
epub: June 8, 2020
PUBMED ID: 32514182
DOI: 10.1038/s41589-020-0558-1
|
| Comments: |
First description of posttranscriptional C to P conversion (position 32) |