| Coding AA: |
Phe |
| Anticodon sequence: |
#AA |
| Organism: |
Homo sapiens
NCBI:txid9606
|
| RNA type: |
cytoplasmic |
| Sequence: |
GCCGAAAUALCUCѢGDDGGGAGAGCRPPAGABU#AA⊆APCUAAG7UC?CUGGTPCGѢUCCCGGGUUUCGGCACCA |
| Unmodified sequence: |
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAGGUCCCUGGUUCGAUCCCGGGUUUCGGCACCA |
| Secondary structure: |
(((((((..((((........)))).(((((.......)))))....(((((.......)))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-21.90 |
| Variants & Diseases: |
|
| Publications: |
- The nature of the modification at position 37 of tRNAPhe correlates with acquired taxol resistance.
Yu Pan, Tong-Meng Yan, Jing-Rong Wang, Zhi-Hong Jiang
Nucleic acids research
volume: 49
issue: 1
date: Jan. 11, 2021
PUBMED ID: 33290562
DOI: 10.1093/nar/gkaa1164
|
| Comments: |
HeLa cell line |