| Coding AA: |
Lys |
| Anticodon sequence: |
3UU |
| Organism: |
Homo sapiens
NCBI:txid9606
|
| RNA type: |
cytoplasmic |
| Sequence: |
GCCCGGAUALCUCAGDCGGDAGAGCAPCAGACU3UU[APCUGAGG7D??AGGGĦPCAѢGUCCCUGUUCGGGCGCCA |
| Unmodified sequence: |
GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA |
| Secondary structure: |
(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-27.50 |
| Publications: |
- Cooperative methylation of human tRNA3Lys at positions A58 and U54 drives the early and late steps of HIV-1 replication.
Hiroyuki Fukuda, Takeshi Chujo, Fan-Yan Wei, Sheng-Lan Shi, Mayumi Hirayama, Taku Kaitsuka, Takahiro Yamamoto, Hiroyuki Oshiumi, Kazuhito Tomizawa
Nucleic acids research
volume: 49
issue: 20
date: Nov. 18, 2021
PUBMED ID: 34642752
DOI: 10.1093/nar/gkab879
|
