We are using technical cookies that are necessary for page to work correctly.

tdbR00000160

NameValue
Coding AA: Ile
Anticodon sequence: }AU
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGCCCCU4AGCUCAGU#GDDAGAGCAGGCGACU}AU6APCGCUUG7XCGCUGGTPCAAGUCCAGCAGGGGCCACCA
Unmodified sequence: GGCCCCUUAGCUCAGUGGUUAGAGCAGGCGACUCAUAAUCGCUUGGUCGCUGGUUCAAGUCCAGCAGGGGCCACCA
Secondary structure: (((((((..((((........))))((((((.......))))))....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:		 Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 3 (June 29, 2026), created: June 29, 2026, modified: Aug. 17, 2026
Folding free energy [kcal/mol]: -33.50
Pre-aligned sequence:
Pre-aligned secondary structure:		 -GGCCCCU4AGCUCAGU--#GDD-AGAGCAGGCGACU}AU6APCGCUUG-------------------7XCGCUGGTPCAAGUCCAGCAGGGGCCACCA
.(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:
  • A novel lysine-substituted nucleoside in the first position of the anticodon of minor isoleucine tRNA from Escherichia coli.
    T Muramatsu, S Yokoyama, N Horie, A Matsuda, T Ueda, Z Yamaizumi, Y Kuchino, S Nishimura, T Miyazawa
    The Journal of biological chemistry
    volume: 263 issue: 19 date: July 5, 1988 PUBMED ID: 3132458
  • Primary structure of AUA-specific isoleucine transfer ribonucleic acid from Escherichia coli.
    Y Kuchino, S Watanabe, F Harada, S Nishimura
    Biochemistry
    volume: 19 issue: 10 date: May 13, 1980 PUBMED ID: 6990971
  • Site-Specific Profiling of 4-Thiouridine Across Transfer RNA Genes in Escherichia coli
    Praneeth Bommisetti, Vahe Bandarian
    ACS omega
    volume: 7 issue: 5 date: Feb. 8, 2022 epub: Jan. 27, 2022 PUBMED ID: 35155896 DOI: 10.1021/acsomega.1c05071
Comments: 18 PARTIALLY G
Previous entry: tdbR00000160 (Aug. 17, 2026, 11:34 a.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: A73; C4-G69; U12-A23; G16; D20; D21; C29-G41; L/k2C34 or C/G34 context; A35; U36; t6A37; A38
Negative identity elements antideterminants of aminoacylation: L/k2C34 is also an antideterminant preventing MetRS recognition/decoding as Met; unmodified C34 impairs Ile identity and can confer Met activity.
Citation: Thiaville,P.C., El Yacoubi,B., K¨ohrer,C., Thiaville,J.J., Deutsch,C., Iwata-Reuyl,D., Bacusmo,J.M., Armengaud,J., Bessho,Y., Wetzel,C. et al. (2015) Essentiality of threonylcarbamoyladenosine (t6A), a universal tRNA modification, in bacteria. Mol. Microbiol., 98, 1199–1221.
DOI: 10.1111/mmi.13209
PMID: 26337258

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer