| Coding AA: |
Leu |
| Anticodon sequence: |
UAG |
| Organism: |
Cocos nucifera
NCBI:txid13894
|
| RNA type: |
cytoplasmic |
| Sequence: |
GACAGUUUGGCCGAGUGGUCUAAGGCGCCAGAUUUAGKCYCUGGUCCGAAAGGGCGUGGGUUCAAAUCCCACAGCUGUCACCA |
| Unmodified sequence: |
GACAGUUUGGCCGAGUGGUCUAAGGCGCCAGAUUUAGGCGCUGGUCCGAAAGGGCGUGGGUUCAAAUCCCACAGCUGUCACCA |
| Secondary structure: |
(((((((..(((...........))).(((((.......)))))...........(((((.......)))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-24.20 |
| Variants & Diseases: |
|
| Publications: |
- A Preliminary Survey of Transfer RNA Modifications and Modifying Enzymes of the Tropical Plant
Meng Chu, Yichao Qin, Xiuying Lin, Li Ma, Dehai Deng, Daizhu Lv, Pengcheng Fu, Huan Lin
Genes
volume: 14
issue: 6
date: June 18, 2023
epub: June 18, 2023
PUBMED ID: 37372467
DOI: 1287
|
| Comments: |
Only part of the modified sequence is mapped to the tRNA |