| Coding AA: |
Asn |
| Anticodon sequence: |
GUU |
| Organism: |
Saccharomyces cerevisiae
NCBI:txid4932
|
| RNA type: |
cytoplasmic |
| Sequence: |
GACUCCAUGLCCAAGDDGGDDAAGGCRUGCGACUGUU6APCGCAAGAD?GUGAGTPCAѢCCCUCACUGGGGUCGCCA |
| Unmodified sequence: |
GACUCCAUGGCCAAGUUGGUUAAGGCGUGCGACUGUUAAUCGCAAGAUCGUGAGUUCAACCCUCACUGGGGUCGCCA |
| Secondary structure: |
(((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Prepared by: |
Database creators |
| Version: |
3 (June 29, 2026), created: June 29, 2026, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: |
-22.90 |
| Variants & Diseases: |
|
| Publications: |
- Direct sequencing of total
Joshua D Jones, Kaley M Simcox, Robert T Kennedy, Kristin S Koutmou
RNA (New York, N.Y.)
volume: 29
issue: 8
epub: May 11, 2023
PUBMED ID: 37169396
DOI: 10.1261/rna.079656.123
|
| Comments: |
Typo on Figure 3. in Asn (left arm has CG at the bottom while it should be GG, as it's in the supplementary data - Table S5) |