We are using technical cookies that are necessary for page to work correctly.

tdbR00000035

NameValue
Coding AA: Asp
Anticodon sequence: GUC
Organism: Saccharomyces cerevisiae NCBI:txid4932
RNA type: cytoplasmic
Sequence: UCCGUGAUAGUUPAADGGDCAGAAUGGGCGCPUGUCKCGUGCCAGAU?GGGGTPCAAUUCCCCGUCGCGGAGCCA
Unmodified sequence: UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAGCCA
Secondary structure: (((((((..((((........)))).(((((.......)))))....(((((.......))))))))))))....
PDB ID: 2tra, 1il2
Prepared by: Database creators
Version: 3 (June 29, 2026), created: June 29, 2026, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -23.70
Pre-aligned sequence:
Pre-aligned secondary structure:
-UCCGUGAUAGUUPAAD--GGDC-AGAAUGGGCGCPUGUCKCGUGCCAG-------------------A-U?GGGGTPCAAUUCCCCGUCGCGGAGCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • The primary structure of aspartate transfer ribonucleic acid from brewer's yeast. II. Partial digestions with pancreatic ribonuclease and T 1 ribonuclease and derivation of complete sequence.
    J Gangloff, G Keith, J P Ebel, G Dirheimer
    Biochimica et biophysica acta
    volume: 259 issue: 2 date: Jan. 31, 1972 PUBMED ID: 4551153
  • Restrained refinement of two crystalline forms of yeast aspartic acid and phenylalanine transfer RNA crystals.
    E Westhof, P Dumas, D Moras
    Acta crystallographica. Section A, Foundations of crystallography
    volume: 44 ( Pt 2) date: March 1, 1988 PUBMED ID: 3272146
  • The structure of an AspRS-tRNA(Asp) complex reveals a tRNA-dependent control mechanism.
    L Moulinier, S Eiler, G Eriani, J Gangloff, J C Thierry, K Gabriel, W H McClain, D Moras
    The EMBO journal
    volume: 20 issue: 18 date: Sept. 17, 2001 PUBMED ID: 11566892
  • Direct sequencing of total Saccharomyces cerevisiae tRNAs by LC-MS/MS
    Joshua D Jones, Kaley M Simcox, Robert T Kennedy, Kristin S Koutmou
    RNA (New York, N.Y.)
    volume: 29 issue: 8 epub: May 11, 2023 PUBMED ID: 37169396 DOI: 10.1261/rna.079656.123
Previous entry: tdbR00000035 (Aug. 17, 2026, 11:47 a.m.)

Secondary structure

Your browser does not support the canvas element.