| Coding AA: |
Asp |
| Anticodon sequence: |
⊄UC |
| Organism: |
Escherichia coli
NCBI:txid562
|
| RNA type: |
cytoplasmic |
| Sequence: |
GGAGCGG4AGUUCAGDCGGDDAGAAUACCUGCCU⊄UC/CGCAGGGG7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA |
| Unmodified sequence: |
GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA |
| Secondary structure: |
(((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))).... |
| PDB ID: |
1c0a, 1efw, 6ugg, 6ugi, 6ugj |
Homology model or
structure extracted from PDB: |
Extracted Download
(last update Sept. 6, 2019)
|
| Prepared by: |
Database creators |
| Version: |
1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019 |
| Folding free energy [kcal/mol]: |
-26.30 |
Pre-aligned sequence:
Pre-aligned secondary structure: |
-GGAGCGG4AGUUCAGDC-GGDD-AGAAUACCUGCCUQUC/CGCAGGGG-------------------7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
- Sequence of the distal tRNA1Asp gene and the transcription termination signal in the Escherichia coli ribosomal RNA operon rrnF(or G).
T Sekiya, M Mori, N Takahashi, S Nishimura
Nucleic acids research
volume: 8
issue: 17
date: Sept. 11, 1980
PUBMED ID: 6255418
- Synthesis of aspartyl-tRNA(Asp) in Escherichia coli--a snapshot of the second step.
S Eiler, A Dock-Bregeon, L Moulinier, J C Thierry, D Moras
The EMBO journal
volume: 18
issue: 22
date: Nov. 15, 1999
PUBMED ID: 10562565
- An intermediate step in the recognition of tRNA(Asp) by aspartyl-tRNA synthetase.
C Briand, A Poterszman, S Eiler, G Webster, J Thierry, D Moras
Journal of molecular biology
volume: 299
issue: 4
date: June 16, 2000
PUBMED ID: 10843857
- A truncated aminoacyl-tRNA synthetase modifies RNA.
Juan C Salazar, Alexandre Ambrogelly, Pamela F Crain, James A McCloskey, Dieter Söll
Proceedings of the National Academy of Sciences of the United States of America
volume: 101
issue: 20
date: May 18, 2004
epub: April 19, 2004
PUBMED ID: 15096612
- Crystal structures of an unmodified bacterial tRNA reveal intrinsic structural flexibility and plasticity as general properties of unbound tRNAs
CW Chan, D Badong, R Rajan, A Mondragon
RNA (New York, N.Y.)
volume: 26
issue: 3: 278-289
date: Feb. 18, 2020
epub: Dec. 17, 2019
PUBMED ID: 31848215
DOI: 10.1261/rna.073478.119
|
| Comments: |
Glutamylated quenosine was previously identified as quenosine probably due to sample preparation conditions |
