tdbR00000026

Name	Value
Coding AA:	Asp
Anticodon sequence:	⊄UC
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	GGAGCGG4AGUUCAGDCGGDDAGAAUACCUGCCU⊄UC/CGCAGGGG7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA
Unmodified sequence:	GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA
Secondary structure:	(((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....
PDB ID:	1c0a, 1efw, 6ugg, 6ugi, 6ugj
Homology model or structure extracted from PDB:	Extracted Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]:	-26.30
Pre-aligned sequence: Pre-aligned secondary structure:	-GGAGCGG4AGUUCAGDC-GGDD-AGAAUACCUGCCUQUC/CGCAGGGG-------------------7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Sequence of the distal tRNA1Asp gene and the transcription termination signal in the Escherichia coli ribosomal RNA operon rrnF(or G). T Sekiya, M Mori, N Takahashi, S Nishimura Nucleic acids research volume: 8 issue: 17 date: Sept. 11, 1980 PUBMED ID: 6255418 Synthesis of aspartyl-tRNA(Asp) in Escherichia coli--a snapshot of the second step. S Eiler, A Dock-Bregeon, L Moulinier, J C Thierry, D Moras The EMBO journal volume: 18 issue: 22 date: Nov. 15, 1999 PUBMED ID: 10562565 An intermediate step in the recognition of tRNA(Asp) by aspartyl-tRNA synthetase. C Briand, A Poterszman, S Eiler, G Webster, J Thierry, D Moras Journal of molecular biology volume: 299 issue: 4 date: June 16, 2000 PUBMED ID: 10843857 A truncated aminoacyl-tRNA synthetase modifies RNA. Juan C Salazar, Alexandre Ambrogelly, Pamela F Crain, James A McCloskey, Dieter Söll Proceedings of the National Academy of Sciences of the United States of America volume: 101 issue: 20 date: May 18, 2004 epub: April 19, 2004 PUBMED ID: 15096612 Crystal structures of an unmodified bacterial tRNA reveal intrinsic structural flexibility and plasticity as general properties of unbound tRNAs. Clarence W Chan, Deanna Badong, Rakhi Rajan, Alfonso Mondragón RNA (New York, N.Y.) volume: 26 issue: 3 epub: Dec. 17, 2019 PUBMED ID: 31848215 DOI: 10.1261/rna.073478.119
Comments:	Glutamylated quenosine was previously identified as quenosine probably due to sample preparation conditions

Secondary structure

Tertiary structure

Model based on:

Moderna

RNA Composer

We are using technical cookies that are necessary for page to work correctly.