We are using technical cookies that are necessary for page to work correctly.

tdbR00000026

NameValue
Coding AA: Asp
Anticodon sequence: ⊄UC
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGAGCGG4AGUUCAGDCGGDDAGAAUACCUGCCU⊄UC/CGCAGGGG7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA
Unmodified sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA
Secondary structure: (((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....
PDB ID: 1c0a, 1efw, 6ugg, 6ugi, 6ugj
Homology model or
structure extracted from PDB:
Extracted Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]: -26.30
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGAGCGG4AGUUCAGDC-GGDD-AGAAUACCUGCCUQUC/CGCAGGGG-------------------7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Sequence of the distal tRNA1Asp gene and the transcription termination signal in the Escherichia coli ribosomal RNA operon rrnF(or G).
    T Sekiya, M Mori, N Takahashi, S Nishimura
    Nucleic acids research
    volume: 8 issue: 17 date: Sept. 11, 1980 PUBMED ID: 6255418
  • Synthesis of aspartyl-tRNA(Asp) in Escherichia coli--a snapshot of the second step.
    S Eiler, A Dock-Bregeon, L Moulinier, J C Thierry, D Moras
    The EMBO journal
    volume: 18 issue: 22 date: Nov. 15, 1999 PUBMED ID: 10562565
  • An intermediate step in the recognition of tRNA(Asp) by aspartyl-tRNA synthetase.
    C Briand, A Poterszman, S Eiler, G Webster, J Thierry, D Moras
    Journal of molecular biology
    volume: 299 issue: 4 date: June 16, 2000 PUBMED ID: 10843857
  • A truncated aminoacyl-tRNA synthetase modifies RNA.
    Juan C Salazar, Alexandre Ambrogelly, Pamela F Crain, James A McCloskey, Dieter Söll
    Proceedings of the National Academy of Sciences of the United States of America
    volume: 101 issue: 20 date: May 18, 2004 epub: April 19, 2004 PUBMED ID: 15096612
  • Crystal structures of an unmodified bacterial tRNA reveal intrinsic structural flexibility and plasticity as general properties of unbound tRNAs.
    Clarence W Chan, Deanna Badong, Rakhi Rajan, Alfonso Mondragón
    RNA (New York, N.Y.)
    volume: 26 issue: 3 epub: Dec. 17, 2019 PUBMED ID: 31848215 DOI: 10.1261/rna.073478.119
Comments: Glutamylated quenosine was previously identified as quenosine probably due to sample preparation conditions

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer