tdbR00000020

Name	Value
Coding AA:	Cys
Anticodon sequence:	GCA
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	GGCGCGU4AACAAAGCGGDDAUGUAGCGGAPUGCA*APCCGUCUAGUCCGGTPCGACUCCGGAACGCGCCUCCA
Unmodified sequence:	GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA
Secondary structure:	(((((((..(((.........))).(((((.......)))))....(((((.......))))))))))))....
PDB ID:	1u0b, 1b23
Homology model or structure extracted from PDB:	Extracted Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]:	-23.70
Pre-aligned sequence: Pre-aligned secondary structure:	-GGCGCGU4AACAAAGC--GGD--DAUGUAGCGGAPUGCA*APCCGUCU-------------------A-GUCCGGTPCGACUCCGGAACGCGCCUCCA .(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Cysteine transfer RNA of Escherichia coli: nucleotide sequence and unusual metabolic properties of the 3' C-C-A terminus. G P Mazzara, W H McClain Journal of molecular biology volume: 117 issue: 4 date: Dec. 25, 1977 PUBMED ID: 342705 Shape-selective RNA recognition by cysteinyl-tRNA synthetase. Scott Hauenstein, Chun-Mei Zhang, Ya-Ming Hou, John J Perona Nature structural & molecular biology volume: 11 issue: 11 epub: Oct. 17, 2004 PUBMED ID: 15489861 The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA. P Nissen, S Thirup, M Kjeldgaard, J Nyborg Structure (London, England : 1993) volume: 7 issue: 2 date: Feb. 15, 1999 PUBMED ID: 10368282

Secondary structure

Tertiary structure

Model based on:

Moderna

RNA Composer

We are using technical cookies that are necessary for page to work correctly.