We are using technical cookies that are necessary for page to work correctly.

tdbR00000020

NameValue
Coding AA: Cys
Anticodon sequence: GCA
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGCGCGU4AACAAAGCGGDDAUGUAGCGGAPUGCA*APCCGUCUAGUCCGGTPCGACUCCGGAACGCGCCUCCA
Unmodified sequence: GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA
Secondary structure: (((((((..(((.........))).(((((.......)))))....(((((.......))))))))))))....
PDB ID: 1u0b, 1b23
Homology model or
structure extracted from PDB:
Extracted Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]: -23.70
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGCGCGU4AACAAAGC--GGD--DAUGUAGCGGAPUGCA*APCCGUCU-------------------A-GUCCGGTPCGACUCCGGAACGCGCCUCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Cysteine transfer RNA of Escherichia coli: nucleotide sequence and unusual metabolic properties of the 3' C-C-A terminus.
    G P Mazzara, W H McClain
    Journal of molecular biology
    volume: 117 issue: 4 date: Dec. 25, 1977 PUBMED ID: 342705
  • Shape-selective RNA recognition by cysteinyl-tRNA synthetase.
    Scott Hauenstein, Chun-Mei Zhang, Ya-Ming Hou, John J Perona
    Nature structural & molecular biology
    volume: 11 issue: 11 epub: Oct. 17, 2004 PUBMED ID: 15489861
  • The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA.
    P Nissen, S Thirup, M Kjeldgaard, J Nyborg
    Structure (London, England : 1993)
    volume: 7 issue: 2 date: Feb. 15, 1999 PUBMED ID: 10368282

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer