| Coding AA: |
Gln |
| Anticodon sequence: |
CUG |
| Organism: |
Escherichia coli
NCBI:txid562
|
| RNA type: |
cytoplasmic |
| Sequence: |
UGGGGUA4CGCCAAGC#GDAAGGCACCGGAJUCUG/PPCCGGCAUUCCGAGGTPCGAAUCCUCGUACCCCAGCCA |
| Unmodified sequence: |
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA |
| Secondary structure: |
(((((((..(((.........))).(((((.......))))).....(((((.......)))))))))))).... |
| PDB ID: |
1o0c, 1qrs, 1qrt, 1qru, 1qtq, 1zjw, 2re8, 4jxx, 4jxz, 4jyz |
Homology model or
structure extracted from PDB: |
Extracted
Download
(last update Sept. 6, 2019)
|
| Prepared by: |
Database creators |
| Version: |
1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025 |
| Folding free energy [kcal/mol]: |
-28.00 |
Pre-aligned sequence:
Pre-aligned secondary structure: |
-UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGAJUCUG/PPCCGGCA-------------------UUCCGAGGTPCGAAUCCUCGUACCCCAGCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
- The nucleotide sequences of the two glutamine transfer ribonucleic acids from Escherichia coli.
M Yaniv, W R Folk
The Journal of biological chemistry
volume: 250
issue: 9
date: May 10, 1975
PUBMED ID: 164464
- Amino acid discrimination by a class I aminoacyl-tRNA synthetase specified by negative determinants.
Timothy L Bullock, Nathan Uter, T Amar Nissan, John J Perona
Journal of molecular biology
volume: 328
issue: 2
date: April 25, 2003
PUBMED ID: 12691748
- Crystal structures of three misacylating mutants of Escherichia coli glutaminyl-tRNA synthetase complexed with tRNA(Gln) and ATP.
J G Arnez, T A Steitz
Biochemistry
volume: 35
issue: 47
date: Nov. 26, 1996
PUBMED ID: 8942633
- How glutaminyl-tRNA synthetase selects glutamine.
V L Rath, L F Silvian, B Beijer, B S Sproat, T A Steitz
Structure (London, England : 1993)
volume: 6
issue: 4
date: April 15, 1998
PUBMED ID: 9562563
- tRNA-dependent aminoacyl-adenylate hydrolysis by a nonediting class I aminoacyl-tRNA synthetase.
Ita Gruic-Sovulj, Nathan Uter, Timothy Bullock, John J Perona
The Journal of biological chemistry
volume: 280
issue: 25
date: June 24, 2005
epub: April 20, 2005
PUBMED ID: 15845536
- A rationally engineered misacylating aminoacyl-tRNA synthetase.
Timothy L Bullock, Annia RodrÃguez-Hernández, Eleonora M Corigliano, John J Perona
Proceedings of the National Academy of Sciences of the United States of America
volume: 105
issue: 21
date: May 27, 2008
epub: May 13, 2008
PUBMED ID: 18477696
DOI: 10.1073/pnas.0711812105
- Structural and mechanistic basis for enhanced translational efficiency by 2-thiouridine at the tRNA anticodon wobble position.
Annia Rodriguez-Hernandez, Jessica L Spears, Kirk W Gaston, Patrick A Limbach, Howard Gamper, Ya-Ming Hou, Rob Kaiser, Paul F Agris, John J Perona
Journal of molecular biology
volume: 425
issue: 20
date: Oct. 23, 2013
epub: May 28, 2013
PUBMED ID: 23727144
DOI: 10.1016/j.jmb.2013.05.018
|
