We are using technical cookies that are necessary for page to work correctly.

tdbR00000332

NameValue
Coding AA: Gln
Anticodon sequence: CUG
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: UGGGGUA4CGCCAAGC#GDAAGGCACCGGAJUCUG/PPCCGGCAUUCCGAGGTPCGAAUCCUCGUACCCCAGCCA
Unmodified sequence: UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA
Secondary structure: (((((((..(((.........))).(((((.......))))).....(((((.......))))))))))))....
PDB ID: 1o0c, 1qrs, 1qrt, 1qru, 1qtq, 1zjw, 2re8, 4jxx, 4jxz, 4jyz
Homology model or
structure extracted from PDB:
Extracted Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]: -28.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGAJUCUG/PPCCGGCA-------------------UUCCGAGGTPCGAAUCCUCGUACCCCAGCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • The nucleotide sequences of the two glutamine transfer ribonucleic acids from Escherichia coli.
    M Yaniv, W R Folk
    The Journal of biological chemistry
    volume: 250 issue: 9 date: May 10, 1975 PUBMED ID: 164464
  • Amino acid discrimination by a class I aminoacyl-tRNA synthetase specified by negative determinants.
    Timothy L Bullock, Nathan Uter, T Amar Nissan, John J Perona
    Journal of molecular biology
    volume: 328 issue: 2 date: April 25, 2003 PUBMED ID: 12691748
  • Crystal structures of three misacylating mutants of Escherichia coli glutaminyl-tRNA synthetase complexed with tRNA(Gln) and ATP.
    J G Arnez, T A Steitz
    Biochemistry
    volume: 35 issue: 47 date: Nov. 26, 1996 PUBMED ID: 8942633
  • How glutaminyl-tRNA synthetase selects glutamine.
    V L Rath, L F Silvian, B Beijer, B S Sproat, T A Steitz
    Structure (London, England : 1993)
    volume: 6 issue: 4 date: April 15, 1998 PUBMED ID: 9562563
  • tRNA-dependent aminoacyl-adenylate hydrolysis by a nonediting class I aminoacyl-tRNA synthetase.
    Ita Gruic-Sovulj, Nathan Uter, Timothy Bullock, John J Perona
    The Journal of biological chemistry
    volume: 280 issue: 25 date: June 24, 2005 epub: April 20, 2005 PUBMED ID: 15845536
  • A rationally engineered misacylating aminoacyl-tRNA synthetase.
    Timothy L Bullock, Annia Rodríguez-Hernández, Eleonora M Corigliano, John J Perona
    Proceedings of the National Academy of Sciences of the United States of America
    volume: 105 issue: 21 date: May 27, 2008 epub: May 13, 2008 PUBMED ID: 18477696 DOI: 10.1073/pnas.0711812105
  • Structural and mechanistic basis for enhanced translational efficiency by 2-thiouridine at the tRNA anticodon wobble position.
    Annia Rodriguez-Hernandez, Jessica L Spears, Kirk W Gaston, Patrick A Limbach, Howard Gamper, Ya-Ming Hou, Rob Kaiser, Paul F Agris, John J Perona
    Journal of molecular biology
    volume: 425 issue: 20 date: Oct. 23, 2013 epub: May 28, 2013 PUBMED ID: 23727144 DOI: 10.1016/j.jmb.2013.05.018

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer